Propagation of TreR regulog to Salmonella enterica subsp. enterica serovar Enteritidis str. P125109

Reference regulog properties
Source regulog:	TreR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Orthologous TF(s)	SEN4206
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Enteritidis str. P125109*
	Locus tag	Position	Score	Sequence
Position: -89 Score: 7.1 Sequence: TTTCGGGAACGTTCCCATTT Locus tag: SEN4204A
	SEN4204A	-89	7.1	TTTCGGGAACGTTCCCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treB
Ortholog function: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655	b4240	-82	6.8	TTTCGGGAACGTTCCCGTTT
Citrobacter koseri ATCC BAA-895	CKO_03571	-137	7.1	TTTCGGGAACGTTCCCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04652	-97	7.1	TTTCGGGAACGTTCCCATTT
Enterobacter sp. 638	Ent638_0439	-87	7.1	TTTCGGGAACGTTCCCATTT
Yersinia pestis KIM	y0166	-321	6.6	AAATGGGAACGTTCCCATTC
Serratia proteamaculans 568	Spro_0529	-105	6.5	AACCGGGAACGTTCCCATTC
Proteus mirabilis HI4320	PMI0291	-78	6.8	TTATGGGAACGTTCCCATTG
Photorhabdus luminescens subsp. laumondii TTO1	plu3288	-107	6.6	TTTTGGGAACGTTCCCATGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --