Propagation of YiaJ regulog to Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
| Source regulog: | YiaJ - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | L-lyxose utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 |
| Orthologous TF(s) | SG3764 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -82
Score: 6 Sequence: ATTTGGAACTAAATTTCGCAT
Locus tag: SG3763
|
||||
| SG3763 | -82 | 6 | ATTTGGAACTAAATTTCGCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yiaK | ||||
| Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3575 | -70 | 6.4 | ATTTGAAATCAAGTTTCGCAT |
| Salmonella typhimurium LT2 | STM3668 | -82 | 6 | ATTTGGAACTAGATTTCGCAT |
| Citrobacter koseri ATCC BAA-895 | CKO_05033 | -72 | 6.5 | ATTTGAAATCAGATTTCGCAT |
| Serratia proteamaculans 568 | Spro_3933 | -74 | 6.1 | ATTTGAAATGCAATTCCGCAT |
|
Position: -168
Score: 6.1 Sequence: ATGCGAAATTTAGTTCCAAAT
Locus tag: SG3764
|
||||
| SG3764 | -168 | 6.1 | ATGCGAAATTTAGTTCCAAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yiaJ | ||||
| Ortholog function: transcriptional regulator of L-lyxose catabolism, IclR family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3574 | -151 | 6.3 | ATGCGAAACTTGATTTCAAAT |
| Salmonella typhimurium LT2 | STM3667 | -168 | 6.2 | ATGCGAAATCTAGTTCCAAAT |
| Citrobacter koseri ATCC BAA-895 | CKO_05032 | -167 | 6.5 | ATGCGAAATCTGATTTCAAAT |