Propagation of Zur regulog to Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 |
| Orthologous TF(s) | SG4084 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -35
Score: 5.8 Sequence: TTATTGTTATGTTATAACATAAT
Locus tag: SG0479
|
||||
| SG0479 | -35 | 5.8 | TTATTGTTATGTTATAACATAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rpmE2 | ||||
| Ortholog function: 50S ribosomal protein L31 paralog | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0296 | -34 | 5.6 | TTATGGTTATGTTATAACATAAC |
| Salmonella typhimurium LT2 | STM0469 | -35 | 5.8 | TTATTGTTATGTTATAACATAAT |
| Citrobacter koseri ATCC BAA-895 | CKO_02696 | -35 | 5.5 | TTATTGTTACGTTATAACATAAT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00435 | -35 | 5.5 | TTATTGTTATGTTATAACGTAAT |
| Enterobacter sp. 638 | Ent638_0934 | -37 | 5.6 | CTTTTGTTATGTTATAACAAAAC |
| Erwinia amylovora ATCC 49946 | EAM_1015 | -36 | 6 | TTTTGGTTATATTATAACATATC |
| Yersinia pestis KIM | y1048 | -36 | 5.9 | ATGATGTTACATTATAACATACT |
| Serratia proteamaculans 568 | Spro_1125 | -36 | 6.2 | TTATTGTTATAGTATAACATTAC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1168 | -31 | 6 | GATATGTTATAACATAACAATTG |
| Proteus mirabilis HI4320 | PMI3379 | -38 | 6.5 | ATATTGTTATATTATAACATTAC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu0036 | -32 | 6.2 | GTAATGTTATATTATTACAATTT |
|
Position: 5
Score: 6.6 Sequence: AGAATGTTATAATATCACATTTC
Locus tag: SG1161
|
||||
| SG1161 | 5 | 6.6 | AGAATGTTATAATATCACATTTC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuA | ||||
| Ortholog function: high-affinity zinc ABC transporter, substrate-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1857 | -52 | 6.5 | GAAATGTTATAATATCACACTTC |
| Salmonella typhimurium LT2 | STM1891 | -52 | 6.6 | AGAATGTTATAATATCACATTTC |
| Citrobacter koseri ATCC BAA-895 | CKO_01106 | -37 | 6.6 | AGAATGTTATAATATCACATTTC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02372 | -100 | 6.3 | TGAATGTTATAATATCACATCAC |
| Enterobacter sp. 638 | Ent638_2426 | -52 | 6.1 | CGAATGTTATAATATCACATCCA |
| Erwinia amylovora ATCC 49946 | EAM_2000 | -52 | 5.9 | CAAATGTTATAATATCACAAAAT |
| Yersinia pestis KIM | y2249 | -51 | 5.6 | TGAATGTTATAATATTACGCTTT |
| Serratia proteamaculans 568 | Spro_2773 | -51 | 5.7 | CGAATGTTATAATATCACGCCTC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2484 | -53 | 6.3 | GTAATGTTATAATATAACAAACA |
| Edwardsiella tarda EIB202 | ETAE_1443 | -50 | 6.6 | GGAATGTTATAATATAACGTTTC |
| Proteus mirabilis HI4320 | PMI1152 | -50 | 6.7 | GAAACGTTATAATATAACATTTC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu2115 | -51 | 6.6 | GAGATGTTATAATATAACAATTC |
|
Position: -54
Score: 6.2 Sequence: GCAATGTTATAATATAACAATCA
Locus tag: SG1861
|
||||
| SG1861 | -54 | 6.2 | GCAATGTTATAATATAACAATCA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: zinT | ||||
| Ortholog function: zinc-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1973 | -56 | 6.3 | TATATGTTACAATATAACATTAC |
| Salmonella typhimurium LT2 | STM1263 | -54 | 6.2 | GCAATGTTATAATATAACAATCA |
| Citrobacter koseri ATCC BAA-895 | CKO_01827 | -91 | 6.8 | GTGATGTTATATTATAACATTCC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04244 | -55 | 5.7 | GATATGTTATATCGTAACAATTT |
| Enterobacter sp. 638 | Ent638_1993 | -53 | 6.1 | GATATGTTATACTATAACATCCT |
| Proteus mirabilis HI4320 | PMI3380 | -38 | 6.5 | ATATTGTTATATTATAACATTAC |