Propagation of TreR regulog to Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601
| Source regulog: | TreR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 |
| Orthologous TF(s) | SSPA3954 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -89
Score: 7.1 Sequence: TTTCGGGAACGTTCCCATTT
Locus tag: SSPA3953
|
||||
| SSPA3953 | -89 | 7.1 | TTTCGGGAACGTTCCCATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: treB | ||||
| Ortholog function: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4240 | -82 | 6.8 | TTTCGGGAACGTTCCCGTTT |
| Citrobacter koseri ATCC BAA-895 | CKO_03571 | -137 | 7.1 | TTTCGGGAACGTTCCCATTT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04652 | -97 | 7.1 | TTTCGGGAACGTTCCCATTT |
| Enterobacter sp. 638 | Ent638_0439 | -87 | 7.1 | TTTCGGGAACGTTCCCATTT |
| Yersinia pestis KIM | y0166 | -321 | 6.6 | AAATGGGAACGTTCCCATTC |
| Serratia proteamaculans 568 | Spro_0529 | -105 | 6.5 | AACCGGGAACGTTCCCATTC |
| Proteus mirabilis HI4320 | PMI0291 | -78 | 6.8 | TTATGGGAACGTTCCCATTG |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu3288 | -107 | 6.6 | TTTTGGGAACGTTCCCATGA |