Propagation of RutR regulog to Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601
| Source regulog: | RutR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 |
| Orthologous TF(s) | SSPA1607 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -294
Score: 6.5 Sequence: ATTTGACCATTTGGTCCACT
Locus tag: SSPA0063
|
||||
| SSPA0063 | -294 | 6.5 | ATTTGACCATTTGGTCCACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: carA | ||||
| Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0032 | -294 | 6.5 | TTTTGACCATTTGGTCCACT |
| Salmonella typhimurium LT2 | STM0066 | -294 | 6.5 | ATTTGACCATTTGGTCCACT |
| Citrobacter koseri ATCC BAA-895 | CKO_03351 | -268 | 6.4 | TTTTGACCAAATGGTCCACT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00040 | -267 | 6.4 | TTTTGACCATCTGGTCCACT |
| Enterobacter sp. 638 | Ent638_0591 | -294 | 5.8 | TTTTGACCATTTGGTCTGGT |
| Erwinia amylovora ATCC 49946 | EAM_0660 | -297 | 6.2 | TTCTGACCATTTGGTCCACT |