Propagation of SoxR regulog to Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601
| Source regulog: | SoxR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 |
| Orthologous TF(s) | SSPA3791 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -76
Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGA
Locus tag: SSPA3790
|
||||
| SSPA3790 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: soxS | ||||
| Ortholog function: Transcriptional activator of superoxide response regulon, AraC family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4062 | -75 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Salmonella typhimurium LT2 | STM4265 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Citrobacter koseri ATCC BAA-895 | CKO_03828 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04462 | -74 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Enterobacter sp. 638 | Ent638_0266 | -87 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Erwinia amylovora ATCC 49946 | EAM_0316 | -92 | 7.1 | ACCTCAAGTAAACTTGAGGA |
|
Position: -30
Score: 7.4 Sequence: TCCTCAAGTTAACTTGAGGT
Locus tag: SSPA3791
|
||||
| SSPA3791 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: soxR | ||||
| Ortholog function: Redox-sensitive transcriptional activator, MerR family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4063 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Salmonella typhimurium LT2 | STM4266 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Citrobacter koseri ATCC BAA-895 | CKO_03827 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04463 | -57 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Enterobacter sp. 638 | Ent638_0267 | -31 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Erwinia amylovora ATCC 49946 | EAM_0317 | -30 | 7.1 | TCCTCAAGTTTACTTGAGGT |