Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CueR regulog to Providencia rustigianii DSM 4541

Reference regulog properties
Source regulog: CueR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Providencia rustigianii DSM 4541
Orthologous TF(s) PROVRUST_01607
Regulated genes 1
Built upon 30 sites [see more]
Predicted regulatory interactions in Providencia rustigianii DSM 4541
Locus tag Position Score Sequence
Position: -128
Score: 5.8
Sequence: ACCTTCCTGTAGGGGGAAGCT
Locus tag: PROVRUST_01744
PROVRUST_01744 -128 5.8 ACCTTCCTGTAGGGGGAAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueO
Ortholog function: Multicopper oxidase
Escherichia coli str. K-12 substr. MG1655 b0123 -73 6.4 ACCTTCCCGTAAGGGGAAGGA
Salmonella typhimurium LT2 STM0168 -62 6.5 ACCTTCCCGTTAGGGCAGGGT
Citrobacter koseri ATCC BAA-895 CKO_03244 -73 6.7 ACCTTCCCGTAAGGGGAGGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00131 -62 6.4 ACCTTCCCGTTACGGTAGGGT
Erwinia amylovora ATCC 49946 EAM_0777 -62 6.2 ACCTTCCCGCTGGGGCAGGGT
Yersinia pestis KIM y0777 -210 6.4 ACCTTCCCCTAAGAGGAGGGT
Serratia proteamaculans 568 Spro_3999 -118 6.3 ACCTTCCGCTAAGGGGAGGGT
Proteus mirabilis HI4320 PMI0159 -108 5.6 ACCTTCCAGTAAGGGGAGACT