Propagation of CueR regulog to Providencia rustigianii DSM 4541

Reference regulog properties
Source regulog:	CueR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Providencia rustigianii DSM 4541
Orthologous TF(s)	PROVRUST_01607
Regulated genes	1

Built upon 30 sites [see more]

Predicted regulatory interactions in *Providencia rustigianii DSM 4541*
	Locus tag	Position	Score	Sequence
Position: -128 Score: 5.8 Sequence: ACCTTCCTGTAGGGGGAAGCT Locus tag: PROVRUST_01744
	PROVRUST_01744	-128	5.8	ACCTTCCTGTAGGGGGAAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueO
Ortholog function: Multicopper oxidase
Escherichia coli str. K-12 substr. MG1655	b0123	-73	6.4	ACCTTCCCGTAAGGGGAAGGA
Salmonella typhimurium LT2	STM0168	-62	6.5	ACCTTCCCGTTAGGGCAGGGT
Citrobacter koseri ATCC BAA-895	CKO_03244	-73	6.7	ACCTTCCCGTAAGGGGAGGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00131	-62	6.4	ACCTTCCCGTTACGGTAGGGT
Erwinia amylovora ATCC 49946	EAM_0777	-62	6.2	ACCTTCCCGCTGGGGCAGGGT
Yersinia pestis KIM	y0777	-210	6.4	ACCTTCCCCTAAGAGGAGGGT
Serratia proteamaculans 568	Spro_3999	-118	6.3	ACCTTCCGCTAAGGGGAGGGT
Proteus mirabilis HI4320	PMI0159	-108	5.6	ACCTTCCAGTAAGGGGAGACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --