Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MprA regulog to Providencia rustigianii DSM 4541

Reference regulog properties
Source regulog: MprA - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector: 2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Providencia rustigianii DSM 4541
Orthologous TF(s) PROVRUST_02827
Regulated genes 2
Built upon 25 sites [see more]
Predicted regulatory interactions in Providencia rustigianii DSM 4541
Locus tag Position Score Sequence
Position: -99
Score: 5.8
Sequence: ATTAGTGTATGTTTGTACTATA
Locus tag: PROVRUST_01779
PROVRUST_01779 -99 5.8 ATTAGTGTATGTTTGTACTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrA
Ortholog function: acriflavin resistance protein A
Escherichia coli str. K-12 substr. MG1655 b0463 -106 6.4 ATTTGTGAATGTATGTACCATA
Salmonella typhimurium LT2 STM0476 -106 5.9 ATTTATGGATGTATGTACCATA
Citrobacter koseri ATCC BAA-895 CKO_02688 -106 6.1 ATTTGTGGATGTATGTACCATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00444 -107 6.4 ATTTGTGAATGTATGTACCATA
Enterobacter sp. 638 Ent638_0943 -107 5.7 ATTTATGAATGTATGTAACATA
Erwinia amylovora ATCC 49946 EAM_1017 -98 6.3 ATTTGCGAATGTATGTACTATA
Yersinia pestis KIM y1050 -109 5.6 ATTCACGAATGTATGTACCATA
Serratia proteamaculans 568 Spro_1127 -107 5.4 ATTCGCGTATGTATGTACCATA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1170 -107 4.5 ATTCAAGTATGTATGTAACATA
Proteus mirabilis HI4320 PMI0132 -117 3.8 GATTTTGACTGAAGTTAATTTA
-90 5.5 ATTCATGTATGTTTGTACTATA
-58 3.7 ATTCATCAACTTAATTATTTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu3851 -94 4.8 ATTCACGTATGTTTGTATTATA
Position: -342
Score: 4.1
Sequence: ATAAATAACCATCTATATTGTA
Locus tag: PROVRUST_02827
PROVRUST_02827 -342 4.1 ATAAATAACCATCTATATTGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mprA
Ortholog function: Transcriptional repressor mprA (EmrR protein)
Escherichia coli str. K-12 substr. MG1655 b2684 -51 6.9 ATTTGTCACTGTCGTTACTATA
Salmonella typhimurium LT2 STM2813 -51 6.9 ATTTGTCACTGTCGTTACTATA
Citrobacter koseri ATCC BAA-895 CKO_04033 -51 6.9 ATTTGTCACTGTCGTTACTATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03013 -150 6.2 ATTTGTCACAATAGTTATTATA
Enterobacter sp. 638 Ent638_3162 -51 6.9 ATTTGTCACTGTCGTTACTATA
Erwinia amylovora ATCC 49946 EAM_2603 -51 5.2 ATTAATCACCATCATTATTATA
Yersinia pestis KIM y0923 -26 6.1 ATTAGTAACTATCGTTACTGTA
Serratia proteamaculans 568 Spro_3741 -50 6.1 ATTAATCACTATCGTTACTATC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3511 -53 5.4 TTTAGTAACATTAGTTACTATG
Edwardsiella tarda EIB202 ETAE_2765 -51 5.1 ACTGATAACCAAAGTTACTATA
Photorhabdus luminescens subsp. laumondii TTO1 plu1277 -51 4.1 TTTGATAACAAAAGTTATCTTA