Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of BetI regulog to Escherichia coli 536

Reference regulog properties
Source regulog: BetI - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Glycine betaine synthesis
Effector: Choline
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli 536
Orthologous TF(s) ECP_0388
Regulated genes 2
Built upon 14 sites [see more]
Predicted regulatory interactions in Escherichia coli 536
Locus tag Position Score Sequence
Position: -48
Score: 6.6
Sequence: TATATTGAACGTCCAATCAA
Locus tag: ECP_0388
ECP_0388 -48 6.6 TATATTGAACGTCCAATCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betI
Ortholog function: transcriptional regulator of glycine betaine synthesis
Escherichia coli str. K-12 substr. MG1655 b0313 -66 6.6 TATATTGAACGTCCAATCAA
Citrobacter koseri ATCC BAA-895 CKO_02582 -48 6.6 TATATTGAACGTCCAATCAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00586 -48 6.6 TATATTGAACGTCCAATCAA
Erwinia amylovora ATCC 49946 EAM_1685 -66 6.9 TTGATTGAACGTTCAATATA
Serratia proteamaculans 568 Spro_1513 -124 7 TTTATTGAACGTTCAATCAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1744 -103 7 TTTATTGAACGTTCAATCAA
Proteus mirabilis HI4320 PMI1461 -68 6.5 TTGATTGAATGTTCAATTAA
Position: -82
Score: 6.7
Sequence: TTGATTGGACGTTCAATATA
Locus tag: ECP_0390
ECP_0390 -82 6.7 TTGATTGGACGTTCAATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betT
Ortholog function: choline transporter of high affinity
Escherichia coli str. K-12 substr. MG1655 b0314 -82 6.7 TTGATTGGACGTTCAATATA
Citrobacter koseri ATCC BAA-895 CKO_02581 -236 6.7 TTGATTGGACGTTCAATATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00587 -82 6.7 TTGATTGGACGTTCAATATA
Erwinia amylovora ATCC 49946 EAM_P133 -243 5.9 TTAATTGAATGCGCAATCAA
Serratia proteamaculans 568 Spro_1512 -308 7 TTGATTGAACGTTCAATAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1743 -274 7 TTGATTGAACGTTCAATAAA
Proteus mirabilis HI4320 PMI1462 -161 6.5 TTAATTGAACATTCAATCAA