Propagation of PhnR regulog to Providencia rettgeri DSM 1131

Reference regulog properties
Source regulog:	PhnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Providencia rettgeri DSM 1131
Orthologous TF(s)	PROVRETT_00133
Regulated genes	3

Built upon 6 sites [see more]

Predicted regulatory interactions in *Providencia rettgeri DSM 1131*
	Locus tag	Position	Score	Sequence
Position: -130 Score: 5.4 Sequence: CTATTGGTCTATACCAGATT Locus tag: PROVRETT_00133
	PROVRETT_00133	-130	5.4	CTATTGGTCTATACCAGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnR
Ortholog function: 2-aminoethylphosphonate utilization regulator, GntR family
Salmonella typhimurium LT2	STM0430	-131	5.3	CCTTTGGTCTATACCAGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04062	-153	5.8	CATTTGGTCTATACCAGATT

Position: -46 Score: 6 Sequence: CATCTGGTATATACCAGGAT Locus tag: PROVRETT_00134
	PROVRETT_00134	-46	6	CATCTGGTATATACCAGGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnS
Ortholog function: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Salmonella typhimurium LT2	STM0429	-48	6	AACCTGGTATAGGCCAGAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04061	-45	6.2	AATCTGGTCTACACCAGAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --