Propagation of GalR/GalS regulog to Providencia rettgeri DSM 1131

Reference regulog properties
Source regulog:	GalR/GalS - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Providencia rettgeri DSM 1131
Orthologous TF(s)	PROVRETT_00447
Regulated genes	1

Built upon 78 sites [see more]

Predicted regulatory interactions in *Providencia rettgeri DSM 1131*
	Locus tag	Position	Score	Sequence
Position: -220 Score: 6.1 Sequence: AAGTGTAAACGTTTTCATTA Locus tag: PROVRETT_00448
	PROVRETT_00448	-220	6.1	AAGTGTAAACGTTTTCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sglT
Ortholog function: predicted sodium/galactose cotransporter
Proteus mirabilis HI4320	PMI1946	-249	4.8	TATTGTAACCGTTATCAAAC
		-58	5.7	AAGTGGAAACGTTTACATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --