Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NikR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-0664

Reference regulog properties
Source regulog: NikR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: NikR
Regulation mode: repressor
Biological process: Nickel homeostasis
Effector: Nickel ion, (Ni2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. E98-0664
Orthologous TF(s) SentesTyph_010100020538
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. E98-0664
Locus tag Position Score Sequence
Position: -101
Score: 6.5
Sequence: GTATGATGTTTTTAAAAGATCGTCATAC
Locus tag: SentesTyph_010100035398
SentesTyph_010100035398 -101 6.5 GTATGATGTTTTTAAAAGATCGTCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yntA
Ortholog function: predicted nickel ABC transporter, substrate-binding protein
Salmonella typhimurium LT2 STM1255 -101 6.5 GTATGATGTTTTTAAAAGATCGTCATAC
Edwardsiella tarda EIB202 ETAE_1580 -171 5.3 GTATGCAGAAGTAAGGAAAAGTGCATAC