Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SoxR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-0664

Reference regulog properties
Source regulog: SoxR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. E98-0664
Orthologous TF(s) SentesTyph_010100034838
Regulated genes 1
Built upon 14 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. E98-0664
Locus tag Position Score Sequence
Position: -30
Score: 7.4
Sequence: TCCTCAAGTTAACTTGAGGT
Locus tag: SentesTyph_010100034838
SentesTyph_010100034838 -30 7.4 TCCTCAAGTTAACTTGAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Escherichia coli str. K-12 substr. MG1655 b4063 -30 7.4 TCCTCAAGTTAACTTGAGGT
Salmonella typhimurium LT2 STM4266 -30 7.4 TCCTCAAGTTAACTTGAGGT
Citrobacter koseri ATCC BAA-895 CKO_03827 -30 7.4 TCCTCAAGTTAACTTGAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04463 -57 7.4 TCCTCAAGTTAACTTGAGGT
Enterobacter sp. 638 Ent638_0267 -31 7.4 TCCTCAAGTTAACTTGAGGT
Erwinia amylovora ATCC 49946 EAM_0317 -30 7.1 TCCTCAAGTTTACTTGAGGT