Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PhnR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E00-7866

Reference regulog properties
Source regulog: PhnR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. E00-7866
Orthologous TF(s) Salmoneentericaenterica_010100008263
Regulated genes 3
Built upon 6 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. E00-7866
Locus tag Position Score Sequence
Position: -48
Score: 6
Sequence: AACCTGGTATAGGCCAGAAA
Locus tag: Salmoneentericaenterica_010100008258
Salmoneentericaenterica_010100008258 -48 6 AACCTGGTATAGGCCAGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnS
Ortholog function: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Salmonella typhimurium LT2 STM0429 -48 6 AACCTGGTATAGGCCAGAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04061 -45 6.2 AATCTGGTCTACACCAGAAT
Position: -131
Score: 5.3
Sequence: CCTTTGGTCTATACCAGATT
Locus tag: Salmoneentericaenterica_010100008263
Salmoneentericaenterica_010100008263 -131 5.3 CCTTTGGTCTATACCAGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnR
Ortholog function: 2-aminoethylphosphonate utilization regulator, GntR family
Salmonella typhimurium LT2 STM0430 -131 5.3 CCTTTGGTCTATACCAGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04062 -153 5.8 CATTTGGTCTATACCAGATT
Position: -28
Score: 6.2
Sequence: AATCTGGTATAGACCAAAGG
Locus tag: Salmoneentericaenterica_010100008268
Salmoneentericaenterica_010100008268 -28 6.2 AATCTGGTATAGACCAAAGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnW
Ortholog function: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Salmonella typhimurium LT2 STM0431 -28 6.2 AATCTGGTATAGACCAAAGG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04063 -29 6.5 AATCTGGTATAGACCAAATG