Propagation of Zur regulog to Escherichia coli O111:H- str. 11128
Source regulog: | Zur - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O111:H- str. 11128 |
Orthologous TF(s) | ECO111_4869 |
Regulated genes | 6 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -53
Score: 6.3 Sequence: GGATTGTTATATTATAACAGTTC
Locus tag: ECO111_1505
|
||||
ECO111_1505 | -53 | 6.3 | GGATTGTTATATTATAACAGTTC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: pliG | ||||
Ortholog function: periplasmic lysozme inhibitor of g-type lysozyme | ||||
Escherichia coli str. K-12 substr. MG1655 | b1178 | -53 | 6.3 | GGATTGTTATATTATAACAGTTC |
Salmonella typhimurium LT2 | STM2610 | -54 | 5.9 | TTATTGTTACAATATAACAATTA |
Position: -52
Score: 6.5 Sequence: GAAATGTTATAATATCACACTTC
Locus tag: ECO111_2379
|
||||
ECO111_2379 | -52 | 6.5 | GAAATGTTATAATATCACACTTC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: znuA | ||||
Ortholog function: high-affinity zinc ABC transporter, substrate-binding protein | ||||
Escherichia coli str. K-12 substr. MG1655 | b1857 | -52 | 6.5 | GAAATGTTATAATATCACACTTC |
Salmonella typhimurium LT2 | STM1891 | -52 | 6.6 | AGAATGTTATAATATCACATTTC |
Citrobacter koseri ATCC BAA-895 | CKO_01106 | -37 | 6.6 | AGAATGTTATAATATCACATTTC |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02372 | -100 | 6.3 | TGAATGTTATAATATCACATCAC |
Enterobacter sp. 638 | Ent638_2426 | -52 | 6.1 | CGAATGTTATAATATCACATCCA |
Erwinia amylovora ATCC 49946 | EAM_2000 | -52 | 5.9 | CAAATGTTATAATATCACAAAAT |
Yersinia pestis KIM | y2249 | -51 | 5.6 | TGAATGTTATAATATTACGCTTT |
Serratia proteamaculans 568 | Spro_2773 | -51 | 5.7 | CGAATGTTATAATATCACGCCTC |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2484 | -53 | 6.3 | GTAATGTTATAATATAACAAACA |
Edwardsiella tarda EIB202 | ETAE_1443 | -50 | 6.6 | GGAATGTTATAATATAACGTTTC |
Proteus mirabilis HI4320 | PMI1152 | -50 | 6.7 | GAAACGTTATAATATAACATTTC |
Photorhabdus luminescens subsp. laumondii TTO1 | plu2115 | -51 | 6.6 | GAGATGTTATAATATAACAATTC |
Position: -49
Score: 6.5 Sequence: GAAGTGTGATATTATAACATTTC
Locus tag: ECO111_2380
|
||||
ECO111_2380 | -49 | 6.5 | GAAGTGTGATATTATAACATTTC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: znuC | ||||
Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein | ||||
Escherichia coli str. K-12 substr. MG1655 | b1858 | -49 | 6.5 | GAAGTGTGATATTATAACATTTC |
Salmonella typhimurium LT2 | STM1892.S | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
Citrobacter koseri ATCC BAA-895 | CKO_01105 | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02373 | -49 | 6.4 | GTGATGTGATATTATAACATTCA |
Enterobacter sp. 638 | Ent638_2427 | -48 | 6.2 | TGGATGTGATATTATAACATTCG |
Erwinia amylovora ATCC 49946 | EAM_2001 | -48 | 6.1 | ATTTTGTGATATTATAACATTTG |
Yersinia pestis KIM | y2250 | -47 | 5.7 | AAAGCGTAATATTATAACATTCA |
Serratia proteamaculans 568 | Spro_2774 | -50 | 5.8 | GAGGCGTGATATTATAACATTCG |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2485 | -46 | 6.4 | TGTTTGTTATATTATAACATTAC |
Edwardsiella tarda EIB202 | ETAE_1442 | -72 | 6.7 | GAAACGTTATATTATAACATTCC |
Proteus mirabilis HI4320 | PMI1151 | -47 | 6.7 | GAAATGTTATATTATAACGTTTC |
Photorhabdus luminescens subsp. laumondii TTO1 | plu2114 | -48 | 6.6 | GAATTGTTATATTATAACATCTC |
Position: -56
Score: 6.2 Sequence: CATATGTTACAATATAACATTAC
Locus tag: ECO111_2552
|
||||
ECO111_2552 | -56 | 6.2 | CATATGTTACAATATAACATTAC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: zinT | ||||
Ortholog function: zinc-binding protein | ||||
Escherichia coli str. K-12 substr. MG1655 | b1973 | -56 | 6.3 | TATATGTTACAATATAACATTAC |
Salmonella typhimurium LT2 | STM1263 | -54 | 6.2 | GCAATGTTATAATATAACAATCA |
Citrobacter koseri ATCC BAA-895 | CKO_01827 | -91 | 6.8 | GTGATGTTATATTATAACATTCC |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04244 | -55 | 5.7 | GATATGTTATATCGTAACAATTT |
Enterobacter sp. 638 | Ent638_1993 | -53 | 6.1 | GATATGTTATACTATAACATCCT |
Proteus mirabilis HI4320 | PMI3380 | -38 | 6.5 | ATATTGTTATATTATAACATTAC |