Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LacI regulog to Escherichia coli O111:H- str. 11128

Reference regulog properties
Source regulog: LacI - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O111:H- str. 11128
Orthologous TF(s) ECO111_0381
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Escherichia coli O111:H- str. 11128
Locus tag Position Score Sequence
Position: -38
Score: 7.4
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: ECO111_0380
ECO111_0380 -38 7.4 AATTGTGAGCGGATAACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lacZ
Ortholog function: Beta-galactosidase (EC 3.2.1.23)
Escherichia coli str. K-12 substr. MG1655 b0344 -38 7.4 AATTGTGAGCGGATAACAATT
Citrobacter koseri ATCC BAA-895 CKO_02825 -38 7 AATTGTGAGCGAATAACAAAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_pKPN3p05871 -37 7.2 AAATGTGAGCGGATAACAATT
Enterobacter sp. 638 Ent638_0928 -29 6.3 AATTGTGAGCGCTTCGCAAAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1490 -73 7.4 AATTGTGAGCGGATAACAATT