Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TrpR regulog to Salmonella enterica subsp. enterica serovar Typhi str. 404ty

Reference regulog properties
Source regulog: TrpR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. 404ty
Orthologous TF(s) Salmonelentericaenterica_010100020291
Regulated genes 2
Built upon 44 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. 404ty
Locus tag Position Score Sequence
Position: -34
Score: 5.6
Sequence: TGTACTCGTGTAACAGTACA
Locus tag: Salmonelentericaenterica_010100020291
Salmonelentericaenterica_010100020291 -34 5.6 TGTACTCGTGTAACAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpR
Ortholog function: Trp operon repressor
Escherichia coli str. K-12 substr. MG1655 b4393 -66 5.3 CGTACTCTTTAGCGAGTACA
Salmonella typhimurium LT2 STM4583 -34 5.6 TGTACTCGTGTAACAGTACA
Citrobacter koseri ATCC BAA-895 CKO_03393 -97 6 CGTACTCGTTAAAGAGTACA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04848 -65 5.7 TGTACTCGTTGAAGAGTACA
Enterobacter sp. 638 Ent638_0554 3 5.5 TGTACTcGTcAAagAGTACA
Erwinia amylovora ATCC 49946 EAM_0634 -33 6.2 TGTACTAGTTAAATAGTATG
Yersinia pestis KIM y3726 -24 6.1 TGTACTAGTTAAATAGTACT
Serratia proteamaculans 568 Spro_0676 -30 6.2 TGTACTAGTTAAATAGTATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3899 -30 6.2 CGTACTAGTTAAATAGTATG
Edwardsiella tarda EIB202 ETAE_0543 -44 5.6 TGTACTCGTTGAATAGTTCA
Proteus mirabilis HI4320 PMI3714 -39 5.2 TGTACTAGTTTATGAGTGTG
Photorhabdus luminescens subsp. laumondii TTO1 plu0557 -34 6.2 TGTACTAGTTAAATAGTATG
Position: -72
Score: 5.9
Sequence: TGTACTCGTGTACTGGTACA
Locus tag: Salmonelentericaenterica_010100033594
Salmonelentericaenterica_010100033594 -72 5.9 TGTACTCGTGTACTGGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtr
Ortholog function: Tryptophan-specific transport protein
Escherichia coli str. K-12 substr. MG1655 b3161 -72 5.9 TGTACTCGTGTACTGGTACA
Salmonella typhimurium LT2 STM3279 -72 5.9 TGTACTCGTGTACTGGTACA
Citrobacter koseri ATCC BAA-895 CKO_04558 -72 5.4 TGTACTCGCGTACTGGTACA
Enterobacter sp. 638 Ent638_3598 -71 5.4 TGTACTCCTGTACTGGTACA