Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GalR/GalS regulog to Yersinia pestis biovar Mediaevalis str. K1973002

Reference regulog properties
Source regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pestis biovar Mediaevalis str. K1973002
Orthologous TF(s) YpK1973002_0768
Regulated genes 3
Built upon 78 sites [see more]
Predicted regulatory interactions in Yersinia pestis biovar Mediaevalis str. K1973002
Locus tag Position Score Sequence
Position: -340
Score: 5.8
Sequence: TTGTGTAACCGGTTTCAATC
Locus tag: YpK1973002_0995
YpK1973002_0995 -340 5.8 TTGTGTAACCGGTTTCAATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: mglB
Ortholog function: beta-methylgalactoside ABC transporter, periplasmic binding protein
Escherichia coli str. K-12 substr. MG1655 b2150 -287 5.3 CGATGTAACCGCTTTCAATC
Citrobacter koseri ATCC BAA-895 CKO_00641 -287 5.5 GGATGTAACCGCTTTCAATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02588 -256 5.4 GGATGTAACCGCTTTCAATT
Enterobacter sp. 638 Ent638_2750 -288 5.8 TGATGTAACCGTTTTCAATC
Yersinia pestis KIM y2662 -229 5.8 TTGTGTAACCGGTTTCAATC
Serratia proteamaculans 568 Spro_1563 -246 6.1 TTGTGTAACCGTTTTCAATC
Position: -95
Score: 6.4
Sequence: GAGTGTAAACGATTCCATTA
Locus tag: YpK1973002_1433
YpK1973002_1433 -95 6.4 GAGTGTAAACGATTCCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galE
Ortholog function: UDP-galactose-4-epimerase
Escherichia coli str. K-12 substr. MG1655 b0759 -96 6.6 TTGTGTAAACGATTCCACTA
Salmonella typhimurium LT2 STM0776 -96 6.4 GTGTGTAAACGATTCCACTA
Citrobacter koseri ATCC BAA-895 CKO_02376 -54 6.4 AAGTGTAAACGATTCCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00773 -252 4.9 CAGTGGAGACGGTTACACTT
-96 6.4 AAGTGTAAACGATTCCACTA
Enterobacter sp. 638 Ent638_1250 -96 6.2 CGGTGTAACCGATTCCACTA
Yersinia pestis KIM y3043 -95 6.4 GAGTGTAAACGATTCCATTA
Edwardsiella tarda EIB202 ETAE_2564 -195 5.5 TAGTGTAAGCGATACCACAA
-95 6.4 TAGTGTAAACGATTCCATTT
Position: -37
Score: 5.4
Sequence: TGATGTAAGCGGTTACCCTA
Locus tag: YpK1973002_0768
YpK1973002_0768 -37 5.4 TGATGTAAGCGGTTACCCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galR
Ortholog function: galactose operon repressor galR
Escherichia coli str. K-12 substr. MG1655 b2837 -32 5.2 GAATGTAAGCGTTTACCCAC
Salmonella typhimurium LT2 STM3011 -33 5.3 TAATGTAAGCGTTTACCCAC
Citrobacter koseri ATCC BAA-895 CKO_04211 -33 5.1 AAATGTAAGCGTTTACCCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03246 -33 5.5 GTATGTAAACGCTTACCCTA
Enterobacter sp. 638 Ent638_3278 -35 5.3 GTGTGTAAACGCTTACCCCC
Erwinia amylovora ATCC 49946 EAM_2770 -35 4.9 AAATGTAAACGCTTACCCAG
Yersinia pestis KIM y3183 32 5.4 TGATGTAAGCGGTTACCCTA
Serratia proteamaculans 568 Spro_3832 -34 5.2 GAATGTAAGCGATTACCCAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3172 -240 5.3 AAGTGTAATCGGTTACCCTA
Edwardsiella tarda EIB202 ETAE_2890 -41 5.2 TGGTGTAAACGTTTACGGTT