Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TrpR regulog to Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066

Reference regulog properties
Source regulog: TrpR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066
Orthologous TF(s) Salmentericaenterica_010100014857
Regulated genes 5
Built upon 44 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066
Locus tag Position Score Sequence
Position: -186
Score: 6.2
Sequence: TGAACCAGTTAACTAGTACG
Locus tag: Salmentericaenterica_010100003100
Salmentericaenterica_010100003100 -186 6.2 TGAACCAGTTAACTAGTACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpE
Ortholog function: Anthranilate synthase, aminase component (EC 4.1.3.27)
Escherichia coli str. K-12 substr. MG1655 b1264 -183 6.3 CGAACTAGTTAACTAGTACG
Salmonella typhimurium LT2 STM1723 -186 6.3 CGAACTAGTTAACTAGTACG
Citrobacter koseri ATCC BAA-895 CKO_01340 -174 6.3 CGAACTAGTTAACTAGTACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01257 -198 6.3 CGAACTAGTTAACTAGTACG
Enterobacter sp. 638 Ent638_2204 -186 6.3 CGAACTAGTTAACTAGTACG
Erwinia amylovora ATCC 49946 EAM_1877 -192 6.2 CGAACCAGTTAACTAGTACA
Yersinia pestis KIM y2051 -283 6.2 TGAACCAGTTAACTAGTACA
Serratia proteamaculans 568 Spro_2667 -219 6.2 CGAACCAGTTAACTAGTACA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2296 -231 6.2 CGAACCAGTTAACTAGTACA
Edwardsiella tarda EIB202 ETAE_1535 -222 5.6 GAAACTAGTTTACTAGTACG
Proteus mirabilis HI4320 PMI1343 -243 5.4 TAATCCAGTTTACTAGTACA
Photorhabdus luminescens subsp. laumondii TTO1 plu2462 -196 5.8 CGTTCCAGTTTACTAGTACA
Position: -79
Score: 5.1
Sequence: TGTACTAGTTAGATGATATG
Locus tag: Salmentericaenterica_010100008859
Salmentericaenterica_010100008859 -79 5.1 TGTACTAGTTAGATGATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: aroL
Ortholog function: Shikimate kinase III (EC 2.7.1.71)
Escherichia coli str. K-12 substr. MG1655 b0388 -79 5.6 TGTACTAGTTTGATGGTATG
Salmonella typhimurium LT2 STM0388 -79 5.1 TGTACTAGTTAGATGATATG
Citrobacter koseri ATCC BAA-895 CKO_02783 -136 5.4 TGTACTAGTTTGGTGGTATG
Enterobacter sp. 638 Ent638_0859 -80 5.6 CGTACTAGTTTAATGGTATT
Position: -34
Score: 5.6
Sequence: TGTACTCGTGTAACAGTACA
Locus tag: Salmentericaenterica_010100014857
Salmentericaenterica_010100014857 -34 5.6 TGTACTCGTGTAACAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpR
Ortholog function: Trp operon repressor
Escherichia coli str. K-12 substr. MG1655 b4393 -66 5.3 CGTACTCTTTAGCGAGTACA
Salmonella typhimurium LT2 STM4583 -34 5.6 TGTACTCGTGTAACAGTACA
Citrobacter koseri ATCC BAA-895 CKO_03393 -97 6 CGTACTCGTTAAAGAGTACA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04848 -65 5.7 TGTACTCGTTGAAGAGTACA
Enterobacter sp. 638 Ent638_0554 3 5.5 TGTACTcGTcAAagAGTACA
Erwinia amylovora ATCC 49946 EAM_0634 -33 6.2 TGTACTAGTTAAATAGTATG
Yersinia pestis KIM y3726 -24 6.1 TGTACTAGTTAAATAGTACT
Serratia proteamaculans 568 Spro_0676 -30 6.2 TGTACTAGTTAAATAGTATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3899 -30 6.2 CGTACTAGTTAAATAGTATG
Edwardsiella tarda EIB202 ETAE_0543 -44 5.6 TGTACTCGTTGAATAGTTCA
Proteus mirabilis HI4320 PMI3714 -39 5.2 TGTACTAGTTTATGAGTGTG
Photorhabdus luminescens subsp. laumondii TTO1 plu0557 -34 6.2 TGTACTAGTTAAATAGTATG
Position: -155
Score: 4.5
Sequence: CAAACTAGTTTAATGGGTTG
Locus tag: Salmentericaenterica_010100022354
Salmentericaenterica_010100022354 -155 4.5 CAAACTAGTTTAATGGGTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: aroH
Ortholog function: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Escherichia coli str. K-12 substr. MG1655 b1704 -164 5.3 TGTACTAGAGAACTAGTGCA
Salmonella typhimurium LT2 STM1347 -163 4.9 TGTACTAGCAAACTAGTTTA
Citrobacter koseri ATCC BAA-895 CKO_01728 -173 4.5 TGTACTAACAAACTAGTGCA
-165 4.5 CAAACTAGTGCAAGAGTTCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02162 -162 4.9 TGTACTAATACACTAGTACA
Enterobacter sp. 638 Ent638_1743 -159 5 TGTACTAATATGCTAGTACA
Edwardsiella tarda EIB202 ETAE_1792 -135 5 TGTACTAGTAAGAAAGTACA