Propagation of CueR regulog to Yersinia pestis biovar Orientalis str. MG05-1020
Source regulog: | CueR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Copper resistance |
Effector: | Copper ion, (Cu+) |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Yersinia pestis biovar Orientalis str. MG05-1020 |
Orthologous TF(s) | YpMG051020_2976, YpMG051020_2409 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -210
Score: 6.4 Sequence: ACCTTCCCCTAAGAGGAGGGT
Locus tag: YpMG051020_4327
|
||||
YpMG051020_4327 | -210 | 6.4 | ACCTTCCCCTAAGAGGAGGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cueO | ||||
Ortholog function: Multicopper oxidase | ||||
Escherichia coli str. K-12 substr. MG1655 | b0123 | -73 | 6.4 | ACCTTCCCGTAAGGGGAAGGA |
Salmonella typhimurium LT2 | STM0168 | -62 | 6.5 | ACCTTCCCGTTAGGGCAGGGT |
Citrobacter koseri ATCC BAA-895 | CKO_03244 | -73 | 6.7 | ACCTTCCCGTAAGGGGAGGGT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00131 | -62 | 6.4 | ACCTTCCCGTTACGGTAGGGT |
Erwinia amylovora ATCC 49946 | EAM_0777 | -62 | 6.2 | ACCTTCCCGCTGGGGCAGGGT |
Yersinia pestis KIM | y0777 | -210 | 6.4 | ACCTTCCCCTAAGAGGAGGGT |
Serratia proteamaculans 568 | Spro_3999 | -118 | 6.3 | ACCTTCCGCTAAGGGGAGGGT |
Proteus mirabilis HI4320 | PMI0159 | -108 | 5.6 | ACCTTCCAGTAAGGGGAGACT |
Position: -194
Score: 6.3 Sequence: ACCTTCACCTTGCTGGAAGGT
Locus tag: YpMG051020_2975
|
||||
YpMG051020_2975 | -194 | 6.3 | ACCTTCACCTTGCTGGAAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: copA | ||||
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4) | ||||
Yersinia pestis KIM | y1093 | -194 | 6.3 | ACCTTCACCTTGCTGGAAGGT |
Edwardsiella tarda EIB202 | ETAE_1039 | -115 | 6.1 | ACCTTAACCTTGCGGGAAGGT |
Position: -33
Score: 5.6 Sequence: ACCTTCCAGCAAGGTGAAGGT
Locus tag: YpMG051020_2976
|
||||
YpMG051020_2976 | -33 | 5.6 | ACCTTCCAGCAAGGTGAAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cueR | ||||
Ortholog function: Copper-responsive transcriptional regulator, MerR family | ||||
Salmonella typhimurium LT2 | STM0499 | -33 | 5.4 | ACCTTCCAGCAAGGTTAAGGT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00465 | -33 | 6.2 | ACCTTCCAGCAAGGGGAAGGT |
Enterobacter sp. 638 | Ent638_0963 | -33 | 5.4 | ACCTTCCAGCAAGGTTAAGGT |
Erwinia amylovora ATCC 49946 | EAM_1045 | -33 | 5.4 | ACCTTCCATCAAGGGGAACGT |
Yersinia pestis KIM | y1094 | -33 | 5.6 | ACCTTCCAGCAAGGTGAAGGT |
Serratia proteamaculans 568 | Spro_1151 | -33 | 6.2 | ACCTTCCAGCAAGGGGAAGGT |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1194 | -33 | 5.6 | ACCTTCTAGCAAGGGGAGGGT |
Edwardsiella tarda EIB202 | ETAE_1040 | -33 | 5.7 | ACCTTCCCGCAAGGTTAAGGT |
Proteus mirabilis HI4320 | PMI2172 | -33 | 6.2 | ACCTTTCCGCAAGGGGAAGGT |
Photorhabdus luminescens subsp. laumondii TTO1 | plu3823 | -33 | 6 | ACCTTCCCTCAAGGGTAAGGT |