Propagation of Zur regulog to Yersinia pestis biovar Orientalis str. MG05-1020
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia pestis biovar Orientalis str. MG05-1020 |
| Orthologous TF(s) | YpMG051020_2325 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -44
Score: 5.7 Sequence: AAAGCGTAATATTATAACATTCA
Locus tag: YpMG051020_3366
|
||||
| YpMG051020_3366 | -44 | 5.7 | AAAGCGTAATATTATAACATTCA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuC | ||||
| Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1858 | -49 | 6.5 | GAAGTGTGATATTATAACATTTC |
| Salmonella typhimurium LT2 | STM1892.S | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Citrobacter koseri ATCC BAA-895 | CKO_01105 | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02373 | -49 | 6.4 | GTGATGTGATATTATAACATTCA |
| Enterobacter sp. 638 | Ent638_2427 | -48 | 6.2 | TGGATGTGATATTATAACATTCG |
| Erwinia amylovora ATCC 49946 | EAM_2001 | -48 | 6.1 | ATTTTGTGATATTATAACATTTG |
| Yersinia pestis KIM | y2250 | -47 | 5.7 | AAAGCGTAATATTATAACATTCA |
| Serratia proteamaculans 568 | Spro_2774 | -50 | 5.8 | GAGGCGTGATATTATAACATTCG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2485 | -46 | 6.4 | TGTTTGTTATATTATAACATTAC |
| Edwardsiella tarda EIB202 | ETAE_1442 | -72 | 6.7 | GAAACGTTATATTATAACATTCC |
| Proteus mirabilis HI4320 | PMI1151 | -47 | 6.7 | GAAATGTTATATTATAACGTTTC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu2114 | -48 | 6.6 | GAATTGTTATATTATAACATCTC |
|
Position: 6
Score: 5.1 Sequence: TATGTGTTACATTATAACGGTTT
Locus tag: YpMG051020_4469
|
||||
| YpMG051020_4469 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ECA3248 | ||||
| Ortholog function: ABC-type uncharacterized transport system, periplasmic component | ||||
| Yersinia pestis KIM | y1329 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT |
| Serratia proteamaculans 568 | Spro_3632 | -3 | 5.3 | TTTATGTTACTTTATAACAATAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3248 | -3 | 5.7 | ATAATGTTACATTATAACGCTTT |
| Proteus mirabilis HI4320 | PMI1519 | -42 | 6.1 | GTGATGTTATATTATAACAAAAT |
|
Position: -36
Score: 5.9 Sequence: ATGATGTTACATTATAACATACT
Locus tag: YpMG051020_1257
|
||||
| YpMG051020_1257 | -36 | 5.9 | ATGATGTTACATTATAACATACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rpmE2 | ||||
| Ortholog function: 50S ribosomal protein L31 paralog | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0296 | -34 | 5.6 | TTATGGTTATGTTATAACATAAC |
| Salmonella typhimurium LT2 | STM0469 | -35 | 5.8 | TTATTGTTATGTTATAACATAAT |
| Citrobacter koseri ATCC BAA-895 | CKO_02696 | -35 | 5.5 | TTATTGTTACGTTATAACATAAT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00435 | -35 | 5.5 | TTATTGTTATGTTATAACGTAAT |
| Enterobacter sp. 638 | Ent638_0934 | -37 | 5.6 | CTTTTGTTATGTTATAACAAAAC |
| Erwinia amylovora ATCC 49946 | EAM_1015 | -36 | 6 | TTTTGGTTATATTATAACATATC |
| Yersinia pestis KIM | y1048 | -36 | 5.9 | ATGATGTTACATTATAACATACT |
| Serratia proteamaculans 568 | Spro_1125 | -36 | 6.2 | TTATTGTTATAGTATAACATTAC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1168 | -31 | 6 | GATATGTTATAACATAACAATTG |
| Proteus mirabilis HI4320 | PMI3379 | -38 | 6.5 | ATATTGTTATATTATAACATTAC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu0036 | -32 | 6.2 | GTAATGTTATATTATTACAATTT |