Propagation of SdaR regulog to Escherichia coli O157:H7 str. EC4401

Reference regulog properties
Source regulog:	SdaR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glucarate utilization; Galactarate utilization
Effector:	Glycerate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Escherichia coli O157:H7 str. EC4401
Orthologous TF(s)	EcoliO157_010100013979
Regulated genes	2

Built upon 31 sites [see more]

Predicted regulatory interactions in *Escherichia coli O157:H7 str. EC4401*
	Locus tag	Position	Score	Sequence
Position: -186 Score: 6 Sequence: TTATGTGCATATGCTCAAAA Locus tag: EcoliO157_010100005298
	EcoliO157_010100005298	-186	6	TTATGTGCATATGCTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: garP
Ortholog function: D-galactarate permease, MFS family
Escherichia coli str. K-12 substr. MG1655	b3127	-186	6	TTATGTGCATATGCTCAAAA
		-144	4.5	AAATTAGCATTTGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03539	-206	4.7	CTTATGGCATAAGCACAATT
Enterobacter sp. 638	Ent638_3569	-208	5.4	GGTTGTGCATATGCTCAAAT

Position: -69 Score: 5.3 Sequence: CTTTAGGCATTTGCACAATG Locus tag: EcoliO157_010100013979
	EcoliO157_010100013979	-69	5.3	CTTTAGGCATTTGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655	b0162	-69	5.3	CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2	STM0210	-71	5.8	TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895	CKO_03205	-17	5.1	GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00177	-17	5.4	CTTAGTGCAAATGCACAATG
Enterobacter sp. 638	Ent638_0702	-71	5.3	CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3300	-80	4.3	CTTTGTTAATTTGCACAATG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --