Propagation of LacI regulog to Escherichia coli O157:H7 str. EC4401
| Source regulog: | LacI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Lactose utilization |
| Effector: | Allolactose |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Escherichia coli O157:H7 str. EC4401 |
| Orthologous TF(s) | ECH7EC4401_5107 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -38
Score: 7.4 Sequence: AATTGTGAGCGGATAACAATT
Locus tag: EcoliO157_010100014789
|
||||
| EcoliO157_010100014789 | -38 | 7.4 | AATTGTGAGCGGATAACAATT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: lacZ | ||||
| Ortholog function: Beta-galactosidase (EC 3.2.1.23) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0344 | -38 | 7.4 | AATTGTGAGCGGATAACAATT |
| Citrobacter koseri ATCC BAA-895 | CKO_02825 | -38 | 7 | AATTGTGAGCGAATAACAAAC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_pKPN3p05871 | -37 | 7.2 | AAATGTGAGCGGATAACAATT |
| Enterobacter sp. 638 | Ent638_0928 | -29 | 6.3 | AATTGTGAGCGCTTCGCAAAG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1490 | -73 | 7.4 | AATTGTGAGCGGATAACAATT |