Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Escherichia coli O157:H7 str. EC4401

Reference regulog properties
Source regulog: MntR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4401
Orthologous TF(s) EcoliO157_010100018286
Regulated genes 3
Built upon 35 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4401
Locus tag Position Score Sequence
Position: -67
Score: 5.3
Sequence: ACACATAGCCGGTGCTATACTT
Locus tag: EcoliO157_010100018251
EcoliO157_010100018251 -67 5.3 ACACATAGCCGGTGCTATACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dps
Ortholog function: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Escherichia coli str. K-12 substr. MG1655 b0812 -67 5.3 ACACATAGCCGGTGCTATACTT
Position: -129
Score: 6.9
Sequence: AGATATAGCACAGGCTATATTA
Locus tag: EcoliO157_010100018286
EcoliO157_010100018286 -129 6.9 AGATATAGCACAGGCTATATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Escherichia coli str. K-12 substr. MG1655 b0817 -129 6.9 AGATATAGCACAGGCTATATTA
Citrobacter koseri ATCC BAA-895 CKO_02301 -129 6.9 AGATATAGCACAGGCTATATTA
Position: -34
Score: 6.9
Sequence: AAACATAGCAAAGGCTATGTTT
Locus tag: EcoliO157_010100022530
EcoliO157_010100022530 -34 6.9 AAACATAGCAAAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transporter, NRAMP family
Escherichia coli str. K-12 substr. MG1655 b2392 -34 6.9 AAACATAGCAAAGGCTATGTTT
Salmonella typhimurium LT2 STM2408 -34 6.9 AAACATAGCAAAGGCTATGTTT
Citrobacter koseri ATCC BAA-895 CKO_00404 -16 6.9 AAACATAGCAAAGGCTATGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02743 -35 7.1 AAACATAGCAAAGGCTATATTT
Enterobacter sp. 638 Ent638_2926 -34 6.8 AAACATAGCAAAGGCTATATCT
Erwinia amylovora ATCC 49946 EAM_2378 -133 6.4 AAGTATAGCAATTGCTATATTT
Serratia proteamaculans 568 Spro_1916 -70 5.5 AAGTGTAGCCGATGCTACATTG