Propagation of BetI regulog to Pantoea ananatis LMG 20103
| Source regulog: | BetI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Glycine betaine synthesis |
| Effector: | Choline |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Pantoea ananatis LMG 20103 |
| Orthologous TF(s) | PANA_2166 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -212
Score: 6.4 Sequence: TTGATTGGATGTTCAATATA
Locus tag: PANA_2165
|
||||
| PANA_2165 | -212 | 6.4 | TTGATTGGATGTTCAATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: betT | ||||
| Ortholog function: choline transporter of high affinity | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0314 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
| Citrobacter koseri ATCC BAA-895 | CKO_02581 | -236 | 6.7 | TTGATTGGACGTTCAATATA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00587 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
| Erwinia amylovora ATCC 49946 | EAM_P133 | -243 | 5.9 | TTAATTGAATGCGCAATCAA |
| Serratia proteamaculans 568 | Spro_1512 | -308 | 7 | TTGATTGAACGTTCAATAAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1743 | -274 | 7 | TTGATTGAACGTTCAATAAA |
| Proteus mirabilis HI4320 | PMI1462 | -161 | 6.5 | TTAATTGAACATTCAATCAA |