Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GntR regulog to Pantoea ananatis LMG 20103

Reference regulog properties
Source regulog: GntR - Enterobacteriales  
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pantoea ananatis LMG 20103
Orthologous TF(s) PANA_3706
Regulated genes 4
Built upon 61 sites [see more]
Predicted regulatory interactions in Pantoea ananatis LMG 20103
Locus tag Position Score Sequence
Position: -110
Score: 6.2
Sequence: CACTGTTACCGGTAACAGTT
Locus tag: PANA_0300
PANA_0300 -110 6.2 CACTGTTACCGGTAACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gadA
Ortholog function: Gluconate 2-dehydrogenase subunit (EC 1.1.99.3)
Erwinia amylovora ATCC 49946 EAM_0336 -133 5.8 TATTGTTACCGGTAACAGTC
Serratia proteamaculans 568 Spro_2136 -131 5.9 ATAAGTTACCGGTAACATTG
© 2009-2020 RegPrecise