Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Pantoea ananatis LMG 20103

Reference regulog properties
Source regulog: RutR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pantoea ananatis LMG 20103
Orthologous TF(s) PANA_4032, PANA_1412
Regulated genes 3
Built upon 13 sites [see more]
Predicted regulatory interactions in Pantoea ananatis LMG 20103
Locus tag Position Score Sequence
Position: -76
Score: 4.1
Sequence: AACAGACCATTTACTCAAAA
Locus tag: PANA_4032
PANA_4032 -76 4.1 AACAGACCATTTACTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rutR
Ortholog function: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01039 -123 4.2 AGTGGACTGGATGGTCAAAA
Serratia proteamaculans 568 Spro_1824 -118 5 AACAGACCATTTGGTCAAAA
© 2009-2020 RegPrecise