Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PdhR regulog to Erwinia pyrifoliae Ep1/96

Reference regulog properties
Source regulog: PdhR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Erwinia pyrifoliae Ep1/96
Orthologous TF(s) EpC_07890
Regulated genes 1
Built upon 44 sites [see more]
Predicted regulatory interactions in Erwinia pyrifoliae Ep1/96
Locus tag Position Score Sequence
Position: -49
Score: 6.7
Sequence: GAAATTGGTATGACCAATTTA
Locus tag: EpC_07890
EpC_07890 -49 6.7 GAAATTGGTATGACCAATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pdhR
Ortholog function: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Escherichia coli str. K-12 substr. MG1655 b0113 -50 6.7 GAAATTGGTAAGACCAATTGA
Salmonella typhimurium LT2 STM0151 -51 6.7 GAAATTGGTAAGACCAATTGA
Citrobacter koseri ATCC BAA-895 CKO_03260 -51 6.7 GAAATTGGTAAGACCAATTGA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00117 -49 6.7 TAAATTGGTAAGACCAATTGA
Enterobacter sp. 638 Ent638_0659 -51 6.7 GAAATTGGTAAGACCAATTGA
Erwinia amylovora ATCC 49946 EAM_0746 -49 6.6 TAAATTGGTATTACCAATTTA
Yersinia pestis KIM y0766 -70 6.8 GAAATTGGTATTACCAATTGA
Serratia proteamaculans 568 Spro_4012 -52 6.8 GAAATTGGTATTACCAATTGA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3790 -51 6.8 GAAATTGGTATTACCAATTGA
Edwardsiella tarda EIB202 ETAE_0658 -74 6.5 GAAATTGGTAATACCAATTTA
Proteus mirabilis HI4320 PMI2047 -69 6.7 TAAATTGGTATTACCAATTGA
Photorhabdus luminescens subsp. laumondii TTO1 plu3624 -315 6.7 TAAATTGGTATTACCAATTGA
© 2009-2020 RegPrecise