Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TrpR regulog to Erwinia pyrifoliae Ep1/96

Reference regulog properties
Source regulog: TrpR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Erwinia pyrifoliae Ep1/96
Orthologous TF(s) No orthologous TFs found
Regulated genes 2
Built upon 44 sites [see more]
Predicted regulatory interactions in Erwinia pyrifoliae Ep1/96
Locus tag Position Score Sequence
Position: -194
Score: 6.4
Sequence: TGAACTAGTTAACTAGTACA
Locus tag: EpC_16740
EpC_16740 -194 6.4 TGAACTAGTTAACTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpE
Ortholog function: Anthranilate synthase, aminase component (EC 4.1.3.27)
Escherichia coli str. K-12 substr. MG1655 b1264 -183 6.3 CGAACTAGTTAACTAGTACG
Salmonella typhimurium LT2 STM1723 -186 6.3 CGAACTAGTTAACTAGTACG
Citrobacter koseri ATCC BAA-895 CKO_01340 -174 6.3 CGAACTAGTTAACTAGTACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01257 -198 6.3 CGAACTAGTTAACTAGTACG
Enterobacter sp. 638 Ent638_2204 -186 6.3 CGAACTAGTTAACTAGTACG
Erwinia amylovora ATCC 49946 EAM_1877 -192 6.2 CGAACCAGTTAACTAGTACA
Yersinia pestis KIM y2051 -283 6.2 TGAACCAGTTAACTAGTACA
Serratia proteamaculans 568 Spro_2667 -219 6.2 CGAACCAGTTAACTAGTACA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2296 -231 6.2 CGAACCAGTTAACTAGTACA
Edwardsiella tarda EIB202 ETAE_1535 -222 5.6 GAAACTAGTTTACTAGTACG
Proteus mirabilis HI4320 PMI1343 -243 5.4 TAATCCAGTTTACTAGTACA
Photorhabdus luminescens subsp. laumondii TTO1 plu2462 -196 5.8 CGTTCCAGTTTACTAGTACA
Position: -111
Score: 5
Sequence: TGTACTAGTTCGATAGTGTG
Locus tag: EpC_24620
EpC_24620 -111 5 TGTACTAGTTCGATAGTGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtr
Ortholog function: Tryptophan-specific transport protein
Erwinia amylovora ATCC 49946 EAM_1150 -112 4.8 TGTACTAGTTCGATGGTGTG