Propagation of BetI regulog to Yersinia pestis biovar Antiqua str. UG05-0454
| Source regulog: | BetI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Glycine betaine synthesis |
| Effector: | Choline |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia pestis biovar Antiqua str. UG05-0454 |
| Orthologous TF(s) | YpUG050454_1910 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -116
Score: 7 Sequence: TTGATTGAACGTTCAATAAA
Locus tag: YpUG050454_1909
|
||||
| YpUG050454_1909 | -116 | 7 | TTGATTGAACGTTCAATAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: betT | ||||
| Ortholog function: choline transporter of high affinity | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0314 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
| Citrobacter koseri ATCC BAA-895 | CKO_02581 | -236 | 6.7 | TTGATTGGACGTTCAATATA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00587 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
| Erwinia amylovora ATCC 49946 | EAM_P133 | -243 | 5.9 | TTAATTGAATGCGCAATCAA |
| Serratia proteamaculans 568 | Spro_1512 | -308 | 7 | TTGATTGAACGTTCAATAAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1743 | -274 | 7 | TTGATTGAACGTTCAATAAA |
| Proteus mirabilis HI4320 | PMI1462 | -161 | 6.5 | TTAATTGAACATTCAATCAA |
|
Position: -115
Score: 7 Sequence: TTTATTGAACGTTCAATCAA
Locus tag: YpUG050454_1910
|
||||
| YpUG050454_1910 | -115 | 7 | TTTATTGAACGTTCAATCAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: betI | ||||
| Ortholog function: transcriptional regulator of glycine betaine synthesis | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0313 | -66 | 6.6 | TATATTGAACGTCCAATCAA |
| Citrobacter koseri ATCC BAA-895 | CKO_02582 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00586 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
| Erwinia amylovora ATCC 49946 | EAM_1685 | -66 | 6.9 | TTGATTGAACGTTCAATATA |
| Serratia proteamaculans 568 | Spro_1513 | -124 | 7 | TTTATTGAACGTTCAATCAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1744 | -103 | 7 | TTTATTGAACGTTCAATCAA |
| Proteus mirabilis HI4320 | PMI1461 | -68 | 6.5 | TTGATTGAATGTTCAATTAA |