Propagation of Zur regulog to Yersinia pestis biovar Antiqua str. UG05-0454
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia pestis biovar Antiqua str. UG05-0454 |
| Orthologous TF(s) | YpUG050454_3676 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -312
Score: 5.9 Sequence: ATGATGTTACATTATAACATACT
Locus tag: YpUG050454_1195
|
||||
| YpUG050454_1195 | -312 | 5.9 | ATGATGTTACATTATAACATACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rpmJ2 | ||||
| Ortholog function: 50S ribosomal protein L36 paralog | ||||
| Salmonella typhimurium LT2 | STM0470 | -35 | 5.8 | TTATTGTTATGTTATAACATAAT |
| Citrobacter koseri ATCC BAA-895 | CKO_02695 | -35 | 5.5 | TTATTGTTACGTTATAACATAAT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00436 | -35 | 5.5 | TTATTGTTATGTTATAACGTAAT |
| Enterobacter sp. 638 | Ent638_0935 | -37 | 5.6 | CTTTTGTTATGTTATAACAAAAC |
| Erwinia amylovora ATCC 49946 | EAM_1014 | -36 | 6 | TTTTGGTTATATTATAACATATC |
| Serratia proteamaculans 568 | Spro_1124 | -36 | 6.2 | TTATTGTTATAGTATAACATTAC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1167 | -31 | 6 | GATATGTTATAACATAACAATTG |
| Edwardsiella tarda EIB202 | ETAE_1964 | -148 | 5.9 | GTATTGTTATAACATAACATATG |
|
Position: 6
Score: 5.1 Sequence: TATGTGTTACATTATAACGGTTT
Locus tag: YpUG050454_1491
|
||||
| YpUG050454_1491 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ECA3248 | ||||
| Ortholog function: ABC-type uncharacterized transport system, periplasmic component | ||||
| Yersinia pestis KIM | y1329 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT |
| Serratia proteamaculans 568 | Spro_3632 | -3 | 5.3 | TTTATGTTACTTTATAACAATAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3248 | -3 | 5.7 | ATAATGTTACATTATAACGCTTT |
| Proteus mirabilis HI4320 | PMI1519 | -42 | 6.1 | GTGATGTTATATTATAACAAAAT |
|
Position: -56
Score: 5.7 Sequence: AAAGCGTAATATTATAACATTCA
Locus tag: YpUG050454_0087
|
||||
| YpUG050454_0087 | -56 | 5.7 | AAAGCGTAATATTATAACATTCA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuC | ||||
| Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1858 | -49 | 6.5 | GAAGTGTGATATTATAACATTTC |
| Salmonella typhimurium LT2 | STM1892.S | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Citrobacter koseri ATCC BAA-895 | CKO_01105 | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02373 | -49 | 6.4 | GTGATGTGATATTATAACATTCA |
| Enterobacter sp. 638 | Ent638_2427 | -48 | 6.2 | TGGATGTGATATTATAACATTCG |
| Erwinia amylovora ATCC 49946 | EAM_2001 | -48 | 6.1 | ATTTTGTGATATTATAACATTTG |
| Yersinia pestis KIM | y2250 | -47 | 5.7 | AAAGCGTAATATTATAACATTCA |
| Serratia proteamaculans 568 | Spro_2774 | -50 | 5.8 | GAGGCGTGATATTATAACATTCG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2485 | -46 | 6.4 | TGTTTGTTATATTATAACATTAC |
| Edwardsiella tarda EIB202 | ETAE_1442 | -72 | 6.7 | GAAACGTTATATTATAACATTCC |
| Proteus mirabilis HI4320 | PMI1151 | -47 | 6.7 | GAAATGTTATATTATAACGTTTC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu2114 | -48 | 6.6 | GAATTGTTATATTATAACATCTC |