Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CueR regulog to Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537

Reference regulog properties
Source regulog: CueR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537
Orthologous TF(s) Salentericaenterica_010100027857, Salentericaenterica_010100005810
Regulated genes 3
Built upon 30 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537
Locus tag Position Score Sequence
Position: -33
Score: 5.4
Sequence: ACCTTCCAGCAAGGTTAAGGT
Locus tag: Salentericaenterica_010100005810
Salentericaenterica_010100005810 -33 5.4 ACCTTCCAGCAAGGTTAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueR
Ortholog function: Copper-responsive transcriptional regulator, MerR family
Salmonella typhimurium LT2 STM0499 -33 5.4 ACCTTCCAGCAAGGTTAAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00465 -33 6.2 ACCTTCCAGCAAGGGGAAGGT
Enterobacter sp. 638 Ent638_0963 -33 5.4 ACCTTCCAGCAAGGTTAAGGT
Erwinia amylovora ATCC 49946 EAM_1045 -33 5.4 ACCTTCCATCAAGGGGAACGT
Yersinia pestis KIM y1094 -33 5.6 ACCTTCCAGCAAGGTGAAGGT
Serratia proteamaculans 568 Spro_1151 -33 6.2 ACCTTCCAGCAAGGGGAAGGT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1194 -33 5.6 ACCTTCTAGCAAGGGGAGGGT
Edwardsiella tarda EIB202 ETAE_1040 -33 5.7 ACCTTCCCGCAAGGTTAAGGT
Proteus mirabilis HI4320 PMI2172 -33 6.2 ACCTTTCCGCAAGGGGAAGGT
Photorhabdus luminescens subsp. laumondii TTO1 plu3823 -33 6 ACCTTCCCTCAAGGGTAAGGT
Position: -97
Score: 6
Sequence: ACCTTAACCTTGCTGGAAGGT
Locus tag: Salentericaenterica_010100005815
Salentericaenterica_010100005815 -97 6 ACCTTAACCTTGCTGGAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Salmonella typhimurium LT2 STM0498 -97 6 ACCTTAACCTTGCTGGAAGGT
Position: -62
Score: 6.5
Sequence: ACCTTCCCGTTAGGGCAGGGT
Locus tag: Salentericaenterica_010100015711
Salentericaenterica_010100015711 -62 6.5 ACCTTCCCGTTAGGGCAGGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueO
Ortholog function: Multicopper oxidase
Escherichia coli str. K-12 substr. MG1655 b0123 -73 6.4 ACCTTCCCGTAAGGGGAAGGA
Salmonella typhimurium LT2 STM0168 -62 6.5 ACCTTCCCGTTAGGGCAGGGT
Citrobacter koseri ATCC BAA-895 CKO_03244 -73 6.7 ACCTTCCCGTAAGGGGAGGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00131 -62 6.4 ACCTTCCCGTTACGGTAGGGT
Erwinia amylovora ATCC 49946 EAM_0777 -62 6.2 ACCTTCCCGCTGGGGCAGGGT
Yersinia pestis KIM y0777 -210 6.4 ACCTTCCCCTAAGAGGAGGGT
Serratia proteamaculans 568 Spro_3999 -118 6.3 ACCTTCCGCTAAGGGGAGGGT
Proteus mirabilis HI4320 PMI0159 -108 5.6 ACCTTCCAGTAAGGGGAGACT