Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PdhR regulog to Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537

Reference regulog properties
Source regulog: PdhR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537
Orthologous TF(s) Salentericaenterica_010100015811
Regulated genes 4
Built upon 44 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537
Locus tag Position Score Sequence
Position: -257
Score: 5.6
Sequence: TACATTGGTTATACCAATTAT
Locus tag: SeW_A0534
SeW_A0534 -257 5.6 TACATTGGTTATACCAATTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cyoA
Ortholog function: cytochrome o ubiquinol oxidase subunit II
Salmonella typhimurium LT2 STM0443 -230 5.6 TACATTGGTTATACCAATTAT
Position: -51
Score: 6.7
Sequence: GAAATTGGTAAGACCAATTGA
Locus tag: Salentericaenterica_010100015811
Salentericaenterica_010100015811 -51 6.7 GAAATTGGTAAGACCAATTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pdhR
Ortholog function: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Escherichia coli str. K-12 substr. MG1655 b0113 -50 6.7 GAAATTGGTAAGACCAATTGA
Salmonella typhimurium LT2 STM0151 -51 6.7 GAAATTGGTAAGACCAATTGA
Citrobacter koseri ATCC BAA-895 CKO_03260 -51 6.7 GAAATTGGTAAGACCAATTGA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00117 -49 6.7 TAAATTGGTAAGACCAATTGA
Enterobacter sp. 638 Ent638_0659 -51 6.7 GAAATTGGTAAGACCAATTGA
Erwinia amylovora ATCC 49946 EAM_0746 -49 6.6 TAAATTGGTATTACCAATTTA
Yersinia pestis KIM y0766 -70 6.8 GAAATTGGTATTACCAATTGA
Serratia proteamaculans 568 Spro_4012 -52 6.8 GAAATTGGTATTACCAATTGA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3790 -51 6.8 GAAATTGGTATTACCAATTGA
Edwardsiella tarda EIB202 ETAE_0658 -74 6.5 GAAATTGGTAATACCAATTTA
Proteus mirabilis HI4320 PMI2047 -69 6.7 TAAATTGGTATTACCAATTGA
Photorhabdus luminescens subsp. laumondii TTO1 plu3624 -315 6.7 TAAATTGGTATTACCAATTGA
Position: -111
Score: 6.4
Sequence: AATTTTGGTATGACCAATGCA
Locus tag: SeW_A2232
SeW_A2232 -111 6.4 AATTTTGGTATGACCAATGCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ndh
Ortholog function: NADH dehydrogenase
Escherichia coli str. K-12 substr. MG1655 b1109 -138 6.4 AATTTTGGTATGACCAATGCA
Salmonella typhimurium LT2 STM1211 -138 6.4 AATTTTGGTATGACCAATGCA
Citrobacter koseri ATCC BAA-895 CKO_01946 -151 6.4 AATTTTGGTATGACCAATGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01106 -136 6.4 AATTTTGGTATGACCAATGCA
Enterobacter sp. 638 Ent638_1624 -137 6.1 AATTTTGGTATGACCAATGCG
Yersinia pestis KIM y1777 -136 6.3 AATTTTGGTATGACCATATGA
Serratia proteamaculans 568 Spro_1926 -137 6.4 AATTTTGGTATGACCAAATAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1815 -137 6.4 AATTTTGGTATGACCAAATAA
Edwardsiella tarda EIB202 ETAE_2070 -150 6.4 AATTTTGGTATGACCAAATTA
Proteus mirabilis HI4320 PMI0875 -141 5.7 AACTTTGGTATGACCATATTG
Photorhabdus luminescens subsp. laumondii TTO1 plu2821 -138 5.8 AATTTTGGTATGACCCACTAA
Position: -71
Score: 5.7
Sequence: AACAATGGTTTTACCAATTGG
Locus tag: Salentericaenterica_010100027537
Salentericaenterica_010100027537 -71 5.7 AACAATGGTTTTACCAATTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfiD
Ortholog function: stress-induced alternate pyruvate formate-lyase subunit
Salmonella typhimurium LT2 STM2646 -71 5.7 AACAATGGTTTTACCAATTGG
Citrobacter koseri ATCC BAA-895 CKO_00205 -70 5.7 AACAATGGTTTTACCAATTGG
Enterobacter sp. 638 Ent638_3064 -67 5.7 AACAATGGTTTTACCAATTGG