Propagation of YiaJ regulog to Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537
Source regulog: | YiaJ - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | IclR |
Regulation mode: | repressor |
Biological process: | L-lyxose utilization |
Effector: | Ascorbate-6-phosphate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537 |
Orthologous TF(s) | Salentericaenterica_010100003911 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -82
Score: 6 Sequence: ATTTGGAACTAGATTTCGCAT
Locus tag: Salentericaenterica_010100003901
|
||||
Salentericaenterica_010100003901 | -82 | 6 | ATTTGGAACTAGATTTCGCAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yiaK | ||||
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent | ||||
Escherichia coli str. K-12 substr. MG1655 | b3575 | -70 | 6.4 | ATTTGAAATCAAGTTTCGCAT |
Salmonella typhimurium LT2 | STM3668 | -82 | 6 | ATTTGGAACTAGATTTCGCAT |
Citrobacter koseri ATCC BAA-895 | CKO_05033 | -72 | 6.5 | ATTTGAAATCAGATTTCGCAT |
Serratia proteamaculans 568 | Spro_3933 | -74 | 6.1 | ATTTGAAATGCAATTCCGCAT |
Position: -168
Score: 6.2 Sequence: ATGCGAAATCTAGTTCCAAAT
Locus tag: Salentericaenterica_010100003911
|
||||
Salentericaenterica_010100003911 | -168 | 6.2 | ATGCGAAATCTAGTTCCAAAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yiaJ | ||||
Ortholog function: transcriptional regulator of L-lyxose catabolism, IclR family | ||||
Escherichia coli str. K-12 substr. MG1655 | b3574 | -151 | 6.3 | ATGCGAAACTTGATTTCAAAT |
Salmonella typhimurium LT2 | STM3667 | -168 | 6.2 | ATGCGAAATCTAGTTCCAAAT |
Citrobacter koseri ATCC BAA-895 | CKO_05032 | -167 | 6.5 | ATGCGAAATCTGATTTCAAAT |