Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Bacillus sp. SG-1

Reference regulog properties
Source regulog: NiaR - Bacillales
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus sp. SG-1
Orthologous TF(s) BSG1_01310
Regulated genes 1
Built upon 26 sites [see more]
Predicted regulatory interactions in Bacillus sp. SG-1
Locus tag Position Score Sequence
Position: -65
Score: 5.2
Sequence: GACATGTGTCTTTACACTAGTA
Locus tag: BSG1_09963
BSG1_09963 -65 5.2 GACATGTGTCTTTACACTAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaY
Ortholog function: Predicted nicotinate-regulated transporter NiaY
Bacillus halodurans C-125 BH3254 -85 5.3 GAAATGTGTCTTGTCATGTGTA
Bacillus clausii KSM-K16 ABC2773 -76 5 AAAAAGTGTCTTGTCACATGAA
© 2009-2020 RegPrecise