Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of IclR regulog to Escherichia coli O157:H7 str. EC4501

Reference regulog properties
Source regulog: IclR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Glyoxylate bypass
Effector: Pyruvate; Glyoxylate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4501
Orthologous TF(s) EcolO15_010100007619
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4501
Locus tag Position Score Sequence
Position: -125
Score: 8.3
Sequence: AAAATGGAAATTGTTTTTGATTTT
Locus tag: EcolO15_010100007594
EcolO15_010100007594 -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: aceB
Ortholog function: malate synthase A
Escherichia coli str. K-12 substr. MG1655 b4014 -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Salmonella typhimurium LT2 STM4183 -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Citrobacter koseri ATCC BAA-895 CKO_03906 -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04395 -117 8.3 AAAATGGAAATTGTTTTTGATTTT
Enterobacter sp. 638 Ent638_0218 -127 8.3 AAAATGGAAATTGTTTTTGATTTT
Yersinia pestis KIM y0015 -147 8.2 AAAATGGAAATCGTTTTTGATTTT
Serratia proteamaculans 568 Spro_4503 -172 8.1 AAAATGGAAATGGTTTTTGATTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3991 -132 8.3 AAAATGGAAATTGTTTTTGATTTT
Proteus mirabilis HI4320 PMI2764 -80 7.6 AAAATGGAATTCATTTTTGATTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu4396 -77 7.9 AAAATGGAAATCGTTTTTGATTTA