Propagation of NanR regulog to Escherichia coli O157:H7 str. EC4501
Source regulog: | NanR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor (activator) |
Biological process: | Sialic acid utilization |
Effector: | N-acetylneuraminic acid |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O157:H7 str. EC4501 |
Orthologous TF(s) | EcolO15_010100022605 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -60
Score: 8.2 Sequence: CTGGTATAACAGGTATAAAGGTA
Locus tag: EcolO15_010100022600
|
||||
EcolO15_010100022600 | -60 | 8.2 | CTGGTATAACAGGTATAAAGGTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: nanA | ||||
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3) | ||||
Escherichia coli str. K-12 substr. MG1655 | b3225 | -60 | 8.2 | CTGGTATAACAGGTATAAAGGTA |
Salmonella typhimurium LT2 | STM3339 | -58 | 8.2 | CTGGTATAACAGGTATAAAGGTA |
Citrobacter koseri ATCC BAA-895 | CKO_04629 | -60 | 8.2 | CTGGTATAACAGGTATAAAGGTA |
Enterobacter sp. 638 | Ent638_3661 | -57 | 8.2 | CTGGTATAACAGGTATAAAGGTA |
Edwardsiella tarda EIB202 | ETAE_1381 | -85 | 8 | CTGGTATAACAGGTATACAGGTA |