Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MarR regulog to Escherichia coli O157:H7 str. EC4501

Reference regulog properties
Source regulog: MarR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4501
Orthologous TF(s) EcolO15_010100010300
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4501
Locus tag Position Score Sequence
Position: -57
Score: 6.8
Sequence: TATACTTGCCTGGGCAATATTA
Locus tag: EcolO15_010100010300
EcolO15_010100010300 -57 6.8 TATACTTGCCTGGGCAATATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: marR
Ortholog function: DNA-binding transcriptional repressor MarR
Escherichia coli str. K-12 substr. MG1655 b1530 -57 6.8 TATACTTGCCTGGGCAATATTA
-22 6.3 ATTACTTGCCAGGGCAACTAAT
Salmonella typhimurium LT2 STM1520 -57 7 TATACTTGCCTGGGCAATAGTA
-22 6.8 ATTACTTGCCGGGGCAACCATT