Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Erwinia amylovora CFBP1430

Reference regulog properties
Source regulog: RutR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Erwinia amylovora CFBP1430
Orthologous TF(s) EAMY_1408
Regulated genes 1
Built upon 13 sites [see more]
Predicted regulatory interactions in Erwinia amylovora CFBP1430
Locus tag Position Score Sequence
Position: -270
Score: 6.2
Sequence: TTCTGACCATTTGGTCCACT
Locus tag: EAMY_2932
EAMY_2932 -270 6.2 TTCTGACCATTTGGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: carA
Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
Escherichia coli str. K-12 substr. MG1655 b0032 -294 6.5 TTTTGACCATTTGGTCCACT
Salmonella typhimurium LT2 STM0066 -294 6.5 ATTTGACCATTTGGTCCACT
Citrobacter koseri ATCC BAA-895 CKO_03351 -268 6.4 TTTTGACCAAATGGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00040 -267 6.4 TTTTGACCATCTGGTCCACT
Enterobacter sp. 638 Ent638_0591 -294 5.8 TTTTGACCATTTGGTCTGGT
Erwinia amylovora ATCC 49946 EAM_0660 -297 6.2 TTCTGACCATTTGGTCCACT
© 2009-2020 RegPrecise