Propagation of GalR/GalS regulog to Sodalis glossinidius str. 'morsitans'
| Source regulog: | GalR/GalS - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor (activator) |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Sodalis glossinidius str. 'morsitans' |
| Orthologous TF(s) | SG0962, SG1983 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -127
Score: 4.8 Sequence: TGCTGTAAACGTTTTCTGTC
Locus tag: SG0962
|
||||
| SG0962 | -127 | 4.8 | TGCTGTAAACGTTTTCTGTC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: galS | ||||
| Ortholog function: galactose operon repressor galS | ||||
| Escherichia coli str. K-12 substr. MG1655 | b2151 | -113 | 5.5 | GGCTGTAACCGTTTCCATTG |
| Salmonella typhimurium LT2 | STM2191 | -121 | 5.4 | GGCTGTAACCGTTTCCATCC |
| Citrobacter koseri ATCC BAA-895 | CKO_00640 | -124 | 4.9 | GCATGTAACCGTTTCCAGCC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02589 | -127 | 5.2 | GGATGTAAACGTTTCCAGCC |
| Enterobacter sp. 638 | Ent638_2751 | -127 | 5.5 | GGATGTAACCGTTTTCATCT |
| Erwinia amylovora ATCC 49946 | EAM_2208 | -128 | 4.9 | GGCTGTAACCGTTTTCATGG |
| Serratia proteamaculans 568 | Spro_1562 | -102 | 5.4 | GTATGTAAACGTTTTCTTTC |