Propagation of MntR regulog to Sodalis glossinidius str. 'morsitans'

Reference regulog properties
Source regulog:	MntR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Sodalis glossinidius str. 'morsitans'
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 35 sites [see more]

Predicted regulatory interactions in *Sodalis glossinidius str. 'morsitans'*
	Locus tag	Position	Score	Sequence
Position: -189 Score: 5.8 Sequence: AAACTTAGCCTGTGCTATATTT Locus tag: SG1674
	SG1674	-189	5.8	AAACTTAGCCTGTGCTATATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transporter, NRAMP family
Escherichia coli str. K-12 substr. MG1655	b2392	-34	6.9	AAACATAGCAAAGGCTATGTTT
Salmonella typhimurium LT2	STM2408	-34	6.9	AAACATAGCAAAGGCTATGTTT
Citrobacter koseri ATCC BAA-895	CKO_00404	-16	6.9	AAACATAGCAAAGGCTATGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02743	-35	7.1	AAACATAGCAAAGGCTATATTT
Enterobacter sp. 638	Ent638_2926	-34	6.8	AAACATAGCAAAGGCTATATCT
Erwinia amylovora ATCC 49946	EAM_2378	-133	6.4	AAGTATAGCAATTGCTATATTT
Serratia proteamaculans 568	Spro_1916	-70	5.5	AAGTGTAGCCGATGCTACATTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --