Propagation of QorR regulog to Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29

Reference regulog properties
Source regulog:	QorR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	HxlR
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 15 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29*
	Locus tag	Position	Score	Sequence
Position: -67 Score: 6.6 Sequence: GTACTTACTAAAAGTAAGTTT Locus tag: Sentente_010100012797
	Sentente_010100012797	-67	6.6	GTACTTACTAAAAGTAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: qorB
Ortholog function: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Citrobacter koseri ATCC BAA-895	CKO_03618	-34	6.6	GTACTTACTAAAAGTAAGTTT
Enterobacter sp. 638	Ent638_0383	-67	6.3	GTACTTACTATAAGTTAGTTA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4449	-81	6.1	GTACTTACTTAAAGTTAGCTT
Escherichia coli str. K-12 substr. MG1655	b4211	-67	6.6	GTACTTACTAAAAGTAAGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04605	-68	6.3	GTACTTACTAAAAGTTAGTTA
Proteus mirabilis HI4320	PMI0976	-68	6.6	GTACTTACTTTTAGTAAGTTT
Salmonella typhimurium LT2	STM4401	-67	6.6	GTACTTACTAAAAGTAAGTTT
Yersinia pestis KIM	y1806	-119	5.9	GTACTTACGTAAAGTGAGTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --