Propagation of NikR regulog to Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29

Reference regulog properties
Source regulog:	NikR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29
Orthologous TF(s)	SeSPB_A3781
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29*
	Locus tag	Position	Score	Sequence
Position: -79 Score: 6.2 Sequence: GTGTGACGTTTTAATCAAATGATCATAC Locus tag: Sentente_010100019725
	Sentente_010100019725	-79	6.2	GTGTGACGTTTTAATCAAATGATCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nxiA
Ortholog function: high-affinity nickel-transporter
Salmonella typhimurium LT2	STM2783	-79	6.2	GTGTGACGTTTTAATCAAATGATCATAC
Edwardsiella tarda EIB202	ETAE_2654	-120	6.9	GTATGACAATTTCATGAAAAGATCATAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --