Propagation of IclR regulog to Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29

Reference regulog properties
Source regulog:	IclR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	Glyoxylate bypass
Effector:	Pyruvate; Glyoxylate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29
Orthologous TF(s)	Sentente_010100019013
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29*
	Locus tag	Position	Score	Sequence
Position: -122 Score: 8.3 Sequence: AAAATGGAAATTGTTTTTGATTTT Locus tag: SeSPB_A4384
	SeSPB_A4384	-122	8.3	AAAATGGAAATTGTTTTTGATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: aceB
Ortholog function: malate synthase A
Escherichia coli str. K-12 substr. MG1655	b4014	-125	8.3	AAAATGGAAATTGTTTTTGATTTT
Salmonella typhimurium LT2	STM4183	-125	8.3	AAAATGGAAATTGTTTTTGATTTT
Citrobacter koseri ATCC BAA-895	CKO_03906	-125	8.3	AAAATGGAAATTGTTTTTGATTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04395	-117	8.3	AAAATGGAAATTGTTTTTGATTTT
Enterobacter sp. 638	Ent638_0218	-127	8.3	AAAATGGAAATTGTTTTTGATTTT
Yersinia pestis KIM	y0015	-147	8.2	AAAATGGAAATCGTTTTTGATTTT
Serratia proteamaculans 568	Spro_4503	-172	8.1	AAAATGGAAATGGTTTTTGATTTT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3991	-132	8.3	AAAATGGAAATTGTTTTTGATTTT
Proteus mirabilis HI4320	PMI2764	-80	7.6	AAAATGGAATTCATTTTTGATTTT
Photorhabdus luminescens subsp. laumondii TTO1	plu4396	-77	7.9	AAAATGGAAATCGTTTTTGATTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --