Propagation of NanR regulog to Salmonella enterica subsp. arizonae serovar 62:z4,z23:--

Reference regulog properties
Source regulog:	NanR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor (activator)
Biological process:	Sialic acid utilization
Effector:	N-acetylneuraminic acid
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Orthologous TF(s)	SARI_04284
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. arizonae serovar 62:z4,z23:--*
	Locus tag	Position	Score	Sequence
Position: -58 Score: 8.2 Sequence: CTGGTATAACAGGTATAAAGGTA Locus tag: SARI_04285
	SARI_04285	-58	8.2	CTGGTATAACAGGTATAAAGGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Escherichia coli str. K-12 substr. MG1655	b3225	-60	8.2	CTGGTATAACAGGTATAAAGGTA
Salmonella typhimurium LT2	STM3339	-58	8.2	CTGGTATAACAGGTATAAAGGTA
Citrobacter koseri ATCC BAA-895	CKO_04629	-60	8.2	CTGGTATAACAGGTATAAAGGTA
Enterobacter sp. 638	Ent638_3661	-57	8.2	CTGGTATAACAGGTATAAAGGTA
Edwardsiella tarda EIB202	ETAE_1381	-85	8	CTGGTATAACAGGTATACAGGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --