Propagation of MalI regulog to Klebsiella pneumoniae NTUH-K2044
| Source regulog: | MalI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Klebsiella pneumoniae NTUH-K2044 |
| Orthologous TF(s) | KP1_2522 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -125
Score: 6.6 Sequence: AAGATAAAACGTTTTATCAC
Locus tag: KP1_2522
|
||||
| KP1_2522 | -125 | 6.6 | AAGATAAAACGTTTTATCAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: malI | ||||
| Ortholog function: Maltose regulon regulatory protein MalI | ||||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_01513 | -46 | 6.6 | AAGATAAAACGTTTTATCGA |