Propagation of MalI regulog to Klebsiella pneumoniae NTUH-K2044

Reference regulog properties
Source regulog:	MalI - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Klebsiella pneumoniae NTUH-K2044
Orthologous TF(s)	KP1_2522
Regulated genes	1

Built upon 19 sites [see more]

Predicted regulatory interactions in *Klebsiella pneumoniae NTUH-K2044*
	Locus tag	Position	Score	Sequence
Position: -125 Score: 6.6 Sequence: AAGATAAAACGTTTTATCAC Locus tag: KP1_2522
	KP1_2522	-125	6.6	AAGATAAAACGTTTTATCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: malI
Ortholog function: Maltose regulon regulatory protein MalI
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_01513	-46	6.6	AAGATAAAACGTTTTATCGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --