Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdaR regulog to Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480

Reference regulog properties
Source regulog: SdaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glucarate utilization; Galactarate utilization
Effector: Glycerate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480
Orthologous TF(s) Senteenterica_010100002280, SeSB_A2902
Regulated genes 2
Built upon 31 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480
Locus tag Position Score Sequence
Position: -71
Score: 5.8
Sequence: TTTTGTGCATTTGCACAATG
Locus tag: Senteenterica_010100002280
Senteenterica_010100002280 -71 5.8 TTTTGTGCATTTGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655 b0162 -69 5.3 CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2 STM0210 -71 5.8 TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895 CKO_03205 -17 5.1 GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00177 -17 5.4 CTTAGTGCAAATGCACAATG
Enterobacter sp. 638 Ent638_0702 -71 5.3 CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3300 -80 4.3 CTTTGTTAATTTGCACAATG
Position: -233
Score: 5.1
Sequence: TTTTGAGCATACGCCCATGA
Locus tag: Senteenterica_010100017343
Senteenterica_010100017343 -233 5.1 TTTTGAGCATACGCCCATGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: garD
Ortholog function: D-galactarate dehydratase (EC 4.2.1.42)
Escherichia coli str. K-12 substr. MG1655 b3128 -250 4.5 CATTGTGCAAATGCTAATTT
-208 6 TTTTGAGCATATGCACATAA
Salmonella typhimurium LT2 STM3250 -276 4.8 CATTGTGCAAACGCTCATTA
-233 5.1 TTTTGAGCATACGCCCATGA
Citrobacter koseri ATCC BAA-895 CKO_04527 -223 5.6 TTTTGAGCATTTGCACAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03540 -206 4.7 AATTGTGCTTATGCCATAAG
Enterobacter sp. 638 Ent638_3570 -224 5.4 ATTTGAGCATATGCACAACC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3578 -316 4.6 GTTGGTGCACTTGCCCTATA
-140 4.2 CTTAGGTCAATTGCATAATG