Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480

Reference regulog properties
Source regulog: MntR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480
Orthologous TF(s) Senteenterica_010100011332
Regulated genes 3
Built upon 35 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480
Locus tag Position Score Sequence
Position: -57
Score: 6.7
Sequence: TAACATAGCAAAGGCTATATTC
Locus tag: Senteenterica_010100006878
Senteenterica_010100006878 -57 6.7 TAACATAGCAAAGGCTATATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: sitA
Ortholog function: Iron and manganese ABC transporter, substrate-binding protein
Salmonella typhimurium LT2 STM2861 -57 6.7 TAACATAGCAAAGGCTATATTC
Citrobacter koseri ATCC BAA-895 CKO_04090 -42 6.7 TAACATAGCAAAGGCTATATTC
Citrobacter koseri ATCC BAA-895 CKO_00940 -88 6.1 AAATATAGCCTGTGCTATGTTG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03078 -76 4.7 ATAAATAGCTTGTGCTATATAA
-57 5.7 TAACATAGCAATGGCTATAAAC
Enterobacter sp. 638 Ent638_1111 -75 6.2 AAATATAGCCTATGCTATATAA
-56 5.3 TAAGATAGCACAGGCTAATTTT
Erwinia amylovora ATCC 49946 EAM_2087 -73 5.6 GGATATAGCCTGTGCTATATGT
-54 4.9 TGTTATAGCAATTGCTATTTAG
Position: -128
Score: 6.8
Sequence: AGATATAGCACAGGCTATGTTT
Locus tag: Senteenterica_010100011332
Senteenterica_010100011332 -128 6.8 AGATATAGCACAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Salmonella typhimurium LT2 STM0835 -128 6.8 AGATATAGCACAGGCTATGTTT
Position: -34
Score: 6.9
Sequence: AAACATAGCAAAGGCTATGTTT
Locus tag: Senteenterica_010100014725
Senteenterica_010100014725 -34 6.9 AAACATAGCAAAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transporter, NRAMP family
Escherichia coli str. K-12 substr. MG1655 b2392 -34 6.9 AAACATAGCAAAGGCTATGTTT
Salmonella typhimurium LT2 STM2408 -34 6.9 AAACATAGCAAAGGCTATGTTT
Citrobacter koseri ATCC BAA-895 CKO_00404 -16 6.9 AAACATAGCAAAGGCTATGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02743 -35 7.1 AAACATAGCAAAGGCTATATTT
Enterobacter sp. 638 Ent638_2926 -34 6.8 AAACATAGCAAAGGCTATATCT
Erwinia amylovora ATCC 49946 EAM_2378 -133 6.4 AAGTATAGCAATTGCTATATTT
Serratia proteamaculans 568 Spro_1916 -70 5.5 AAGTGTAGCCGATGCTACATTG