Propagation of PdhR regulog to Yersinia bercovieri ATCC 43970
| Source regulog: | PdhR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Pyruvate metabolism |
| Effector: | Pyruvate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia bercovieri ATCC 43970 |
| Orthologous TF(s) | YberA_01001522 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -74
Score: 5.6 Sequence: AACAATGGTTTTACCAAATAA
Locus tag: YberA_01001208
|
||||
| YberA_01001208 | -74 | 5.6 | AACAATGGTTTTACCAAATAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yfiD | ||||
| Ortholog function: stress-induced alternate pyruvate formate-lyase subunit | ||||
| Yersinia pestis KIM | y1282 | -73 | 6 | AACATTGGTTTTACCAAATAA |
| Serratia proteamaculans 568 | Spro_3682 | -82 | 5.5 | AACAATGGTTTTACCAAATGG |
| Edwardsiella tarda EIB202 | ETAE_2732 | -89 | 5.9 | AACATTGGTTTTACCAAATGG |
| Proteus mirabilis HI4320 | PMI1898 | -75 | 5.7 | AACATTGGTTAGACCAAATAC |
|
Position: -137
Score: 6.4 Sequence: AATTTTGGTATGACCAAATAA
Locus tag: YberA_01001669
|
||||
| YberA_01001669 | -137 | 6.4 | AATTTTGGTATGACCAAATAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ndh | ||||
| Ortholog function: NADH dehydrogenase | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1109 | -138 | 6.4 | AATTTTGGTATGACCAATGCA |
| Salmonella typhimurium LT2 | STM1211 | -138 | 6.4 | AATTTTGGTATGACCAATGCA |
| Citrobacter koseri ATCC BAA-895 | CKO_01946 | -151 | 6.4 | AATTTTGGTATGACCAATGCA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_01106 | -136 | 6.4 | AATTTTGGTATGACCAATGCA |
| Enterobacter sp. 638 | Ent638_1624 | -137 | 6.1 | AATTTTGGTATGACCAATGCG |
| Yersinia pestis KIM | y1777 | -136 | 6.3 | AATTTTGGTATGACCATATGA |
| Serratia proteamaculans 568 | Spro_1926 | -137 | 6.4 | AATTTTGGTATGACCAAATAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1815 | -137 | 6.4 | AATTTTGGTATGACCAAATAA |
| Edwardsiella tarda EIB202 | ETAE_2070 | -150 | 6.4 | AATTTTGGTATGACCAAATTA |
| Proteus mirabilis HI4320 | PMI0875 | -141 | 5.7 | AACTTTGGTATGACCATATTG |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu2821 | -138 | 5.8 | AATTTTGGTATGACCCACTAA |