Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GalR/GalS regulog to Yersinia frederiksenii ATCC 33641

Reference regulog properties
Source regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia frederiksenii ATCC 33641
Orthologous TF(s) YfreA_01002272, YfreA_01001788
Regulated genes 4
Built upon 78 sites [see more]
Predicted regulatory interactions in Yersinia frederiksenii ATCC 33641
Locus tag Position Score Sequence
Position: -38
Score: 5.5
Sequence: TGATGTAAGCGATTACCCTG
Locus tag: YfreA_01001788
YfreA_01001788 -38 5.5 TGATGTAAGCGATTACCCTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: galR
Ortholog function: galactose operon repressor galR
Escherichia coli str. K-12 substr. MG1655 b2837 -32 5.2 GAATGTAAGCGTTTACCCAC
Salmonella typhimurium LT2 STM3011 -33 5.3 TAATGTAAGCGTTTACCCAC
Citrobacter koseri ATCC BAA-895 CKO_04211 -33 5.1 AAATGTAAGCGTTTACCCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03246 -33 5.5 GTATGTAAACGCTTACCCTA
Enterobacter sp. 638 Ent638_3278 -35 5.3 GTGTGTAAACGCTTACCCCC
Erwinia amylovora ATCC 49946 EAM_2770 -35 4.9 AAATGTAAACGCTTACCCAG
Yersinia pestis KIM y3183 32 5.4 TGATGTAAGCGGTTACCCTA
Serratia proteamaculans 568 Spro_3832 -34 5.2 GAATGTAAGCGATTACCCAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3172 -240 5.3 AAGTGTAATCGGTTACCCTA
Edwardsiella tarda EIB202 ETAE_2890 -41 5.2 TGGTGTAAACGTTTACGGTT
Position: -340
Score: 6.1
Sequence: TTGTGTAACCGTTTTCAATC
Locus tag: YfreA_01002271
YfreA_01002271 -340 6.1 TTGTGTAACCGTTTTCAATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: mglB
Ortholog function: beta-methylgalactoside ABC transporter, periplasmic binding protein
Escherichia coli str. K-12 substr. MG1655 b2150 -287 5.3 CGATGTAACCGCTTTCAATC
Citrobacter koseri ATCC BAA-895 CKO_00641 -287 5.5 GGATGTAACCGCTTTCAATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02588 -256 5.4 GGATGTAACCGCTTTCAATT
Enterobacter sp. 638 Ent638_2750 -288 5.8 TGATGTAACCGTTTTCAATC
Yersinia pestis KIM y2662 -229 5.8 TTGTGTAACCGGTTTCAATC
Serratia proteamaculans 568 Spro_1563 -246 6.1 TTGTGTAACCGTTTTCAATC
Position: -155
Score: 5.4
Sequence: GTATGTAAACGTTTTCTTTC
Locus tag: YfreA_01002272
YfreA_01002272 -155 5.4 GTATGTAAACGTTTTCTTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: galactose operon repressor galS
Escherichia coli str. K-12 substr. MG1655 b2151 -113 5.5 GGCTGTAACCGTTTCCATTG
Salmonella typhimurium LT2 STM2191 -121 5.4 GGCTGTAACCGTTTCCATCC
Citrobacter koseri ATCC BAA-895 CKO_00640 -124 4.9 GCATGTAACCGTTTCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02589 -127 5.2 GGATGTAAACGTTTCCAGCC
Enterobacter sp. 638 Ent638_2751 -127 5.5 GGATGTAACCGTTTTCATCT
Erwinia amylovora ATCC 49946 EAM_2208 -128 4.9 GGCTGTAACCGTTTTCATGG
Serratia proteamaculans 568 Spro_1562 -102 5.4 GTATGTAAACGTTTTCTTTC
© 2009-2020 RegPrecise